Последовательности днк кодирующие аминокислоты

Сегодня предлагаем ознакомится со статьей на тему: последовательности днк кодирующие аминокислоты с профессиональным описанием и объяснением.

Последовательности днк кодирующие аминокислоты

244-245

Генетический код, активация аминокислот

А. Генетический код

Большая часть генетической информации, содержащейся в ДНК, кодирует последовательность аминокислот. Процесс экспрессии генетической информации включает транскрипцию «текста», записанного на «языке нуклеиновой кислоты», в текст, записанный на «языке белков». Таково происхождение термина трансляция (дословно — перевод), используемого для обозначения процесса биосинтеза белков. Правила, которым следует трансляция, называют генетическим кодом .

Поскольку в биосинтезе участвуют 20 аминокислот, называемых протеиногенными, «язык» нуклеиновых кислот должен содержать по крайней мере 20 слов ( кодонов ) Однако в аминокислотном «алфавите» имеется только четыре «буквы» (А, Г, Ц и У или Т [или в англ. транскрипции: A, G, С и U или Т*]), так что для получения 20 различных слов каждое должно состоять по крайней мере из трех букв. Кодоны действительно включают три азотистых основания ( триплет нуклеотидов ). На схеме 1 представлен стандартный код ДНК ( последовательность триплетов в некодирующей цепи ), изображенный в виде круга. Схема читается от центра наружу, так что, например, триплет CAT кодирует аминокислоту гистидин. ДНК-кодоны идентичны таковым в мРНК (mRNA), за исключением того, что в мРНК вместо урацила (U), характерного для ДНК, стоит тимин (Т).

В качестве примера прочтения кода на схеме 2 показаны короткие участки нормального и мутантного гена β-глобина вместе с соответствующими последовательностями мРНК и аминокислот. Здесь показаны относительно часто встречающиеся точковые мутации, в результате которых остаток глутаминовой кислоты в положении 6 β-цепи заменен на валин. Такой мутантный гемоглобин в дезоксиформе склонен к агрегации, что вызывает деформацию эритроцитов и уменьшает эффективность транспорта кислорода ( серповидноклеточная анемия ).

В триплетном генетическом коде для 20 аминокислот потенциально существует 4 3 = 64 кодона. Таким образом, большинство аминокислот записывается несколькими кодонами, т. е. генетический код является вырожденным . Кроме того, имеются три триплета, которые обозначают конец транскрипции ( стоп-кодоны ). Еще один специальный кодон, стартовый (инициирующий) кодон, маркирует начало трансляции. Генетический код, показанный на рисунке, является почти универсальным. Этому стандарту не полностью соответствуют только митохондрии (см. с. 212) и некоторые микроорганизмы.

Б. Активация аминокислот

Для каждой из 20 аминокислот имеется соответствующая аминоацил-тРНК-лигаза, которая в цитоплазме соединяет аминокислоту с тPHK(tRNA) (см. с. 88). Этот процесс активации аминокислот осуществляется в две стадии. Сначала аминокислота связывается с ферментом и реагирует с АТФ (АТР), образуя макроэргический смешанный ангидрид — аминоациладенилат. Затем аминоацильный остаток переносится на концевую 3′-ОН-группу концевого остатка рибозы тРНК (другой группой лигаз аминоацил переносится на 2′-ОН-группу). В аминоацил-тРНК карбоксильная группа аминокислотного остатка этерифицируется остатком рибозы 3′-концевого остатка аденозина, входящего в последовательность . ССА-3′.

Точность трансляции зависит, прежде всего, от субстратной специфичности аминоацил-тРНК-лигаз. Корректирующий механизм активного центра лигазы обеспечивает немедленное удаление ошибочно присоединенных аминокислотных остатков. В среднем встречается только одна ошибка на 1300 аминокислотных остатков — поразительно высокая точность «работы», если представить, насколько близки структуры некоторых аминокислот.

В. Asp-тРНК-лигаза (димер)

Процесс активации аминокислот представлен на примере лигазы, специфичной для аспарагиновой кислоты. Молекулы фермента (окрашены в оранжевый цвет) связаны между собой в димер, причем каждая субъединица ассоциирована с одной молекулой тРНК (окрашены в голубой цвет). В активном центре присутствует остаток АТФ (окрашен в зеленый цвет), связанный с 3′-концом тРНК Другой домен белка (слева вверху) отвечает за «узнавание» антикодона тРНК.

* Эти буквы обозначают основания, входящие в нуклеотиды, и происходят от их английских названий: аденин (А), гуанин (G), цитозин (С) и урацил (U) или тимин (Т). — Прим. ред.

Последовательности днк кодирующие аминокислоты

Небольшой экскурс в историю кодов можно прочитать здесь: Общие свойства кодов

СВОЙСТВА ГЕНЕТИЧЕСКОГО КОДА

Проектное задание с кубиками и

поздравление с праздником.

Для «перевода» с языка азотистых оснований нуклеиновых кислот (ДНК и РНК) на язык белков (последовательность аминокислот в полипептидной цепи) можно воспользоваться Таблицей генетического кода или онлайновой машиной-переводчиком ( EMBOSS Transeq ), созданной в Европейском институте биоинформатитки (European Bioinformatics Institute). Протеиновая машина расположена по адресу http://www.ebi.ac.uk/Tools/st/emboss_transeq/. На рисунке ниже представлена рабочая часть машины-переводчика.

Под названием вы видите ссылку на таблицу генетического кода, список для выбора типа кода (по умолчанию — Standard, об этом списке см. ниже) и поле для ввода последовательности нуклеотидов ДНК (Enter or Paste a nucleic acid Sequence). Перевод осуществляется нажатием на расположенную ниже кнопку Run.

При этом программа переходит на новую страницу, на которой представлены условия выбора и результаты ее работы — создана последовательность аминокислот полипептида, закодированная введенной вами иР НК.
При этом указывается, из скольких звеньев состояла иР НК, сколько аминокислот в полипептидной цепочке, что это за аминокислоты ( RDLCCVX — последовательность Аргинин — Аспарагиновая кислота — Лейцин — Цистеин — Цистеин — Валин, см. условные обозначения).
Выбор в стартовом окне в списке Colour позволяет (на новой странице с отчетом) увидеть полипептидную цепь, в которой отдельные аминокислоты имеют разный цвет в зависимости от их свойств. Выбор в списке Reverse позволяет определить аминокислотную последовательность не по иРНК (или по комплементарной нити ДНК) , а по смысловой нити ДНК. В списке Region определяется, с какого нуклеотида надо начинать считывание информации (с первого в триплете или с другого).

1. Триплетность — каждая аминокислота кодируется тремя нуклеотидами. Три нуклеотида, являющиеся единицей кода, называются триплетом, или кодоном.
Генетический код не может быть одинарным, т.к. нуклеотидов ДНК всего 4, а аминокислот — 20.
Кодировать аминокислоты двумя нуклеотидами каждую также недостаточно, т.к. возможно только 4 2 = 16 вариантов. Следующий логически вариант — кодировать аминокислоту тремя нуклеотидами, т.к. возможно 4 3 = 64 варианта.

Читайте так же:  Виды аминокислот входящих в состав белка

Откройте страницу EMBOSS Transeq, скопируйте через буфер обмена приведенную ниже последовательность нуклеотидов в окно Enter or Paste a nucleic acid Sequence
auguccagagcauacccguauucu
или наберите в нем свою последовательность, и переведите приведенную последовательность в белок, нажав кнопку кнопку Run.

2. Триплеты не отграничены друг от друга, но есть сочетания нуклеотидов, обозначающих «точку», конец считывания — «стоп-кодоны» .

Переведите с помощью EMBOSS Transeq приведенную ниже последовательность в белок. Обратите внимание, что фрагмент состоит из 24 мономеров. Сколько аминокислот в пептиде? Вывод — что обозначает * ?
auguacccguauuccagagcauag

Откройте таблицу генетического кода и найдите в ней стоп-кодоны. Какие сочетания нуклеотидов их кодируют?

3. Вырожденность — одна аминокислота может кодироваться несколькими разными триплетами.
Вырожденность является следствием триплетности кода, т.к. четыре нуклеотида, взятые по 3, могут закодировать 4 3 = 64 разных объекта, тогда как аминокислот всего 20 . Убедимся на примере.

Ниже приведены две последовательности нуклеотидов, различающиеся между собой по 11 позициям из 18. Переведите с помощью EMBOSS Transeq обе последовательности в белки. Сколько аминокислотных различий между ними?
1) augucuagauuaggcuca 2) augagccggcucggaagu

4. Универсальность — генетический код одинаков для всех живых организмов на Земле, т.е. в клетке любого из существ одинаковая последовательность нуклеотидов будет кодировать ту же аминокислоту (см. рис. слева внизу).
Впрочем, правильнее утверждать, что генетический код практически универсален, т.к. в некоторых генетических системах (например, в генах митохондрий и хлоропластов) есть некоторые отличия от стандартного кода, присущего организмам.

Переведите с помощью EMBOSS Transeq приведенную ниже последовательность в белок, используя основной (Standard) вариант кода. Запишите полученный белок.
uacagacccauaugcgguacuuga

Вернитесь к стартовой странице EMBOSS Transeq и откройте список (красная стрелка на рисунке ниже), а в нем выберите второй вариант кода — Vertebrate Mitochondrial (2).

Снова введите в окно для ДНК ту же последовательность нуклеотидов (или воспользуйтесь уже введенной, если вернулись на страницу с помощью «Назад» браузера). Запишите полученный белок и сравните с полученным ранее.
Поэкспериментируйте с кодами других генетических систем.

Как Вы думаете, какое значение для организмов имеет то, что генетический код клеток и митохондрий различен? Каковы причины этого?

Перевод одного и того же фрагмента разными кодами позволяет решить несколько олимпиадных задач:

1. Полную последовательность нуклеотидов и-РНК со всеми кодонам перевести каждым из кодов и построить филогенетическое древо кодов по полученным аминокислотным последовательностям (и положению стоп-кодонов). В результате может получиться, например, такое древо (спасибо Statistica for Windows ) .
2. Показав различия между кодами разных генетических систем, постарайтесь найти подтверждения теории, по которой исторически более ранним был вариант кода с двумя значимыми нуклеотидами и третьим-разделителем.

5. Неперекрываемость : каждый участок ДНК хранит информацию не более чем об одном белке. Иными словами, если участок ДНК кодирует белок, то не может кодировать (начиная с какого-нибудь другого нуклеотида) другой белок.

Переведите с помощью EMBOSS Transeq приведенную ниже последовательность в белок. Запишите полученный белок. А теперь попробуйте удалить первые два нуклеотида и получить другой пептид, представив, что генетический перекрывается. Запишите полученный пептид и сравните с первым.
uaugcuaagauuccuuucgga

Правильнее утверждать, что генетический код практически неперекрываемый, т.к. у вирусов, у которых большое количество информации должно поместиться в небольшом фрагменте, наблюдается двойное, а у фага f Х 147 — даже тройное перекрывание (небольшой участок входит одновременно в 3 разных гена).

[2]

Что имеет большую массу — белок или кодирующий его структурный ген? Решите задачу: 1) для глюкагона, состоящего из 29 аминокислотных остатков; 2) в общем виде — для белка из N аминокислотных остатков (вспомни, какое свойство генетического кода лежит в основе задачи).

Теперь, когда ты стал опытным дешифровщиком, попробуй решить обратную задачу: по молекуле белка восстановить состав (точнее, один из возможных вариантов — вспомни, какое свойство генетического кода делает ответ неоднозначным)
Аминокислоты : Метионин — Аргинин — Лизин — Валин — Триптофан — (стоп-кодон)
Видимо, стОит воспользоваться таблицей генетического кода.

M S R L GS

M S * L GS

Обратитесь к текстовой иллюстрации свойств кода и точковых мутаций (пример взят из «Основ современной генетики» С.М. Гершензона + пример на английском языке из Hocking S. OCR A2 Biology Student Book) — файл Иллюстрация свойств кода. Придумайте собственную фразу из трехбуквенных слов, которая бы иллюстрировала все свойства генетического кода); перекрываемость генетического кода у вирусов; различия в общем и митохондриальном кодах. Как это можно проиллюстрировать?

Проектное задание
На рисунке слева — кубики аминокислот с кодонами. Это неплохое проектное задание для 10-классников: сделать такой конструктор для учеников 9 класса, знакомящихся с биосинтезом белка впервые (только сделать всё по уму, с антикодонами т-РНК). Заодно предложите подумать над таким вопросом:
Чтение и ферменты

В описании биосинтеза белка лингвистические аналогии достаточно распространены. Транскрипция знакома по изучению английского: запись произношения того же слова на том же языке, но чуть иными символами и с иной целью. Трансляция и вовсе «перевод»: с языка нуклеотидов на язык аминокислот. Это, так сказать, эпический зачин.
Обслуживают все процессы биосинтеза белка различные ферменты: РНК-полимеразы, аминоацил-т-РНК-синтетазы, ДНК-гиразы и т.д., и т.п. Вопрос: какой (какие) из этих ферментов умеют читать , т.е. понимают смысл того текста, который переводят?
Можно не спешить с ответом, а подождать до темы о регуляции генной активности.
См. также кодо-додекаэдр.

Закодированное поздравление

Приведенная ниже последовательность является поздравлением с праздником. Перекодируйте с языка оснований ДНК на язык аминокислот, чтобы узнать, с каким:

Биосинтез белка. Генетический код

Наследственная информация – это информация о строении белка (информация о том, какие аминокислоты в каком порядке соединять при синтезе первичной структуры белка).

Информация о строении белков закодирована в ДНК, которая у эукариот входит в состав хромосом и находится в ядре. Участок ДНК (хромосомы), в котором закодирована информация об одном белке, называется ген.

Читайте так же:  Какие аминокислоты входят состав

Транскрипция – это переписывание информации с ДНК на иРНК (информационную РНК). иРНК переносит информацию из ядра в цитоплазму, к месту синтеза белка (к рибосоме).

Трансляция – это процесс биосинтеза белка. Внутри рибосомы к кодонам иРНК по принципу комплементарности присоединяются антикодоны тРНК. Рибосома пептидной связью соединяет между собой аминокислоты, принесенные тРНК, получается белок.

Реакции транскрипции, трансляции, а так же репликации (удвоения ДНК) являются реакциями матричного синтеза. ДНК служит матрицей для синтеза иРНК, иРНК служит матрицей для синтеза белка.

Генетический код – это способ, с помощью которого информация о строении белка записана в ДНК.

Свойства генкода

1) Триплетность: одна аминокислота кодируется тремя нуклеотидами. Эти 3 нуклеотида в ДНК называются триплет, в иРНК – кодон, в тРНК – антикодон (но в ЕГЭ может быть и «кодовый триплет» и т.п.)

2) Избыточность (вырожденность): аминокислот всего 20, а триплетов, кодирующих аминокислоты – 61, поэтому каждая аминокислота кодируется несколькими триплетами.

3) Однозначность: каждый триплет (кодон) кодирует только одну аминокислоту.

4) Универсальность: генетический код одинаков для всех живых организмов на Земле.

Задачи на количество нуклеотидов/аминокислот
3 нуклеотида = 1 триплет = 1 аминокислота = 1 тРНК

Задачи на АТГЦ
ДНК иРНК тРНК
А У А
Т А У
Г Ц Г
Ц Г Ц

Раздел 3. Определение последовательности аминокислот в белке по исходной ДНК

Задания по цитологии С5

Раздел 1. Определение %-ного содержания нуклеотидов в ДНК

1. В молекуле ДНК содержится 17% аденина. Определите, сколько (в %) в этой молекуле содержится Т, Г, Ц.

2. В молекуле ДНК содержится 31% аденина. Определите, сколько (в %) в этой молекуле содержится Т, Г, Ц.

3. В молекуле ДНК содержится 26% тимина. Определите, сколько (в %) в этой молекуле содержится А, Г, Ц.

4. В молекуле ДНК содержится 11% тимина. Определите, сколько (в %) в этой молекуле содержится А, Г, Ц.

5. В молекуле ДНК содержится 7% гуанина. Определите, сколько (в %) в этой молекуле содержится А, Т, Ц.

6. В молекуле ДНК содержится 23% гуанина. Определите, сколько (в %) в этой молекуле содержится А, Т, Ц.

7. В молекуле ДНК содержится 19% цитозина. Определите, сколько (в %) в этой молекуле содержится А, Т, Г.

8. В молекуле ДНК содержится 40% цитозина. Определите, сколько (в %) в этой молекуле содержится А, Т, Г.

9. Участок одной из двух цепей молекулы ДНК со­держит 300 нуклеотидов с аденином (А), 100 нуклеотидов с ти­мином (Т), 150 нуклеотидов с гуанином (Г) и 200 нуклеотидов с цитозином (Ц). Какое число нуклеотидов с А, Т, Г и Ц содержится в двуцепочечной молекуле ДНК? Сколько аминокислот должен со­держать белок, кодируемый этим участком молекулы ДНК? Ответ поясните.

10. Участок одной из двух цепей молекулы ДНК со­держит 35 нуклеотидов с аденином (А), 70 нуклеотидов с ти­мином (Т), 70 нуклеотидов с гуанином (Г) и 35 нуклеотидов с цитозином (Ц). Какое число нуклеотидов с А, Т, Г и Ц содержится в двуцепочечной молекуле ДНК? Сколько аминокислот должен со­держать белок, кодируемый этим участком молекулы ДНК? Ответ поясните.

11. Участок одной из двух цепей молекулы ДНК со­держит 50 нуклеотидов с аденином (А), 70 нуклеотидов с ти­мином (Т), 200 нуклеотидов с гуанином (Г) и 70 нуклеотидов с цитозином (Ц). Какое число нуклеотидов с А, Т, Г и Ц содержится в двуцепочечной молекуле ДНК? Сколько аминокислот должен со­держать белок, кодируемый этим участком молекулы ДНК? Ответ поясните.

12. Участок одной из двух цепей молекулы ДНК со­держит 20 нуклеотидов с аденином (А), 10 нуклеотидов с ти­мином (Т), 15 нуклеотидов с гуанином (Г) и 9 нуклеотидов с цитозином (Ц). Какое число нуклеотидов с А, Т, Г и Ц содержится в двуцепочечной молекуле ДНК? Сколько аминокислот должен со­держать белок, кодируемый этим участком молекулы ДНК? Ответ поясните.

13. В молекуле ДНК находится 1400 нуклеотидов с тимином, что составляет 5% от их общего числа. Определите, сколько нуклеотидов с гуанином (Г), цитозином (Ц), аденином (А) содержится в отдельности в молекуле ДНК, и объясните получен­ные результаты.

14. В молекуле ДНК находится 1100 нуклеотидов с аденином, что составляет 10% от их общего числа. Определите, сколько нуклеотидов с тимином (Т), гуанином (Г), цитозином (Ц) содержится в отдельности в молекуле ДНК, и объясните получен­ный результат.

Видео удалено.
Видео (кликните для воспроизведения).

15. В молекуле ДНК находится 160 нуклеотидов, содержащих гуанин (Г), что составляет 20% от их общего числа. Определите число нуклеотидов с тимином (Т), аденином (А), цито­зином (Ц) в отдельности в молекуле ДНК и объясните полученные результаты.

16. В молекуле ДНК находится 500 нуклеотидов, содержащих цитозин (Ц), что составляет 25% от их общего числа. Определите число нуклеотидов с тимином (Т), аденином (А), гуанином (Г) в отдельности в молекуле ДНК и объясните полученные результаты.

Раздел 2. Определение количества нуклеотидов и аминокислот

17. В трансляции участвовало 30 молекул т-РНК. Определите количество аминокислот, входящих в состав образующегося белка, а также число триплетов и нуклеотидов в гене, который кодирует этот белок.

18. В трансляции участвовало 50 молекул т-РНК. Определите количество аминокислот, входящих в состав образующегося белка, а также число триплетов и нуклеотидов в гене, который кодирует этот белок.

19. В трансляции участвовало 80 молекул т-РНК. Определите количество аминокислот, входящих в состав образующегося белка, а также число триплетов и нуклеотидов в гене, который кодирует этот белок.

20. В трансляции участвовало 75 молекул т-РНК. Определите количество аминокислот, входящих в состав образующегося белка, а также число триплетов и нуклеотидов в гене, который кодирует этот белок.

Читайте так же:  Топ самых лучших жиросжигателей для женщин

21. В трансляции участвовало 110 молекул т-РНК. Определите количество аминокислот, входящих в состав образующегося белка, а также число триплетов и нуклеотидов в гене, который кодирует этот белок.

22. Фрагмент ДНК состоит из 72 нуклеотидов. Определите число триплетов и нуклеотидов в иРНК, а также количество аминокислот, входящих в состав образующегося белка.

23. Фрагмент ДНК состоит из 51 нуклеотидов. Определите число триплетов и нуклеотидов в иРНК, а также количество аминокислот, входящих в состав образующегося белка.

24. Фрагмент ДНК состоит из 93 нуклеотидов. Определите число триплетов и нуклеотидов в иРНК, а также количество аминокислот, входящих в состав образующегося белка.

25. Фрагмент ДНК состоит из 66 нуклеотидов. Определите число триплетов и нуклеотидов в иРНК, а также количество аминокислот, входящих в состав образующегося белка.

26. Фрагмент ДНК состоит из 120 нуклеотидов. Определите число триплетов и нуклеотидов в иРНК, а также количество аминокислот, входящих в состав образующегося белка.

27. Полипептид состоит из 20 аминокислот. Определи­те число нуклеотидов на участке гена, который кодирует первичную структуру этого полипептида, число кодонов на и-РНК, соответ­ствующее этим аминокислотам, и число молекул т-РНК, участвую­щих в биосинтезе этого полипептида. Ответ поясните.

28. Белок состоит из 150 аминокислот. Установите число нуклеотидов участков молекул и-РНК и ДНК, кодирующих данные аминокислоты, и общее число молекул т-РНК, которые необходимы для переноса этих аминокислот к месту синтеза. Ответ поясните.

29. Белок состоит из 100 аминокислот. Установи­те, во сколько раз молекулярная масса участка гена, кодирующего данный белок, превышает молекулярную массу белка, если средняя молекулярная масса аминокислоты – 110, а нуклеотида – 300. От­вет поясните.

30. Участок цепи ДНК, кодирующий первичную структуру полипептида, состоит из 15 нуклеотидов. Определите число нуклеотидов на и-РНК, кодирующих аминокислоты, число аминокислот в полипептиде и количество т-РНК, необходимых для переноса этих аминокислот к месту синтеза. Ответ поясните.

31. Информационная часть и-РНК содержит 120 нуклеоти­дов. Определите число аминокислот, входящих в кодируемый ею белок, число молекул т-РНК, участвующих в процессе биосинтеза этого белка, число триплетов в участке гена, кодирующих первичную структуру этого белка. Объясните полученные результаты.

32. Фрагмент нуклеотидной цепи ДНК имеет по­следовательность А-А-Г-Т-Г-А-Ц. Определите нуклеотидную по­следовательность второй цепи и общее число водородных связей, которые образуются между двумя цепями. Объясните полученные результаты.

33. Две цепи молекулы ДНК удерживаются друг про­тив друга водородными связями. Определите число нуклеотидов с аденином, тимином, гуанином и цитозином в молекуле ДНК, в которой 30 нуклеотидов соединяются между собой двумя водо­родными связями, и 20 нуклеотидов — тремя водородными связями. Объясните полученные результаты.

Раздел 3. Определение последовательности аминокислот в белке по исходной ДНК

34. Фрагмент одной из цепей ДНК имеет следующее строение: ААГГЦТАЦГТТГ. Постройте на ней и-РНК и определите последовательность аминокислот в фрагменте молекулы белка и антикодоны т-РНК (для этого используйте таблицу генетического кода).

35. Фрагмент одной из цепей ДНК имеет следующее строение: ГГЦТЦТАГЦТТЦ. Постройте на ней и-РНК и определите последовательность аминокислот в фрагменте молекулы белка и антикодоны т-РНК (для этого используйте таблицу генетического кода).

36. Фрагмент одной из цепей ДНК имеет следующее строение: ААГЦГТГЦТЦАГ. Постройте на ней и-РНК и определите последовательность аминокислот в фрагменте молекулы белка и антикодоны т-РНК (для этого используйте таблицу генетического кода).

37. Фрагмент одной из цепей ДНК имеет следующее строение: ЦЦАТАТЦЦГГАТ. Постройте на ней и-РНК и определите последовательность аминокислот в фрагменте молекулы белка и антикодоны т-РНК (для этого используйте таблицу генетического кода).

38. Фрагмент одной из цепей ДНК имеет следующее строение: АГТТТЦТГГЦАА. Постройте на ней и-РНК и определите последовательность аминокислот в фрагменте молекулы белка и антикодоны т-РНК (для этого используйте таблицу генетического кода).

39. Фрагмент одной из цепей ДНК имеет следующее строение: ГАТТАЦЦТАГТТ. Постройте на ней и-РНК и определите последовательность аминокислот в фрагменте молекулы белка и антикодоны т-РНК (для этого используйте таблицу генетического кода).

40. Фрагмент одной из цепей ДНК имеет следующее строение: ЦТАТЦЦГЦТГТЦ. Постройте на ней и-РНК и определите последовательность аминокислот в фрагменте молекулы белка и антикодоны т-РНК (для этого используйте таблицу генетического кода).

41. Фрагмент одной из цепей ДНК имеет следующее строение: ААГЦТАЦАГАЦЦ. Постройте на ней и-РНК и определите последовательность аминокислот в фрагменте молекулы белка и антикодоны т-РНК (для этого используйте таблицу генетического кода).

42. Фрагмент одной из цепей ДНК имеет следующее строение: ГГТГЦЦГГАААГ. Постройте на ней и-РНК и определите последовательность аминокислот в фрагменте молекулы белка и антикодоны т-РНК (для этого используйте таблицу генетического кода).

43. Фрагмент одной из цепей ДНК имеет следующее строение: ЦЦЦГТАААТТЦГ. Постройте на ней и-РНК и определите последовательность аминокислот в фрагменте молекулы белка и антикодоны т-РНК (для этого используйте таблицу генетического кода).

44. Фрагмент молекулы ДНК, определяющий первичную структуру полипептида, имеет последовательность нуклеотидов ГТЦАТГГЦТТАГ. Определите аминокислотную последовательность, а также последовательность и-РНК, число т-РНК и нуклеотидный состав их антикодонов, участвующих в биосинтезе белка. Объясните полученные результаты.

Дата добавления: 2018-06-01 ; просмотров: 406 ; ЗАКАЗАТЬ РАБОТУ

Последовательности днк кодирующие аминокислоты

Трансляция нуклеотидной последовательности

Если нужно найти редкие кодоны, то лучше использовать форму «Поиск редких кодонов в кодирующей последовательности» (кстати, она выдаёт пронумерованные последовательности). Различные манипуляции с нуклеотидной последовательностью (чтение в обратную сторону, чтение комплементарной, перевод в двухцепочечную) можно выполнить с помощью специальной формы. Имеется программа для чтения нуклеотидной последовательности вслух.

Стандартные обозначения полиморфных позиций:

Символ Обозначает Объяснение
R A или G puRine
Y C или T pYrimidine
M A или C aMino
K G или T Keto
S C или G сильное /Strong/ взаимодействие — три
водородные связи
W A или T слабое /Weak/ взаимодействие — две
водородные связи
H (A, C, T) но не G H следует за G в алфавите
B (C, G, T) но не A B следует за A в алфавите
V (A, C, G) но не T(U) V следует за T(U) в алфавите
D (A, G, T) но не C D следует за C в алфавите
N (A, G, C, T) любое основание / Nucleotide
Читайте так же:  Спортивное питание флекс спорт

Дополнения, комментарии, вопросы

IPB WARNING [2] mysql_connect() [function.mysql-connect]: User molbiol_forum already has more than ‘max_user_connections’ active connections (Line: 115 of /ips_kernel/class_db_mysql.php)
Invision Power Board Database Error

There appears to be an error with the database.
You can try to refresh the page by clicking here.

We apologise for any inconvenience

Последовательности генома, не кодирующие белок

В настоящее время накапливается всё больше данных, противоречащих идее о некодирующих последовательностях как «мусорной ДНК» (англ. junk DNA). Теломеры и центромерысодержат малое число генов, но они важны для функционирования и стабильности хромосом. Часто встречающаяся форма некодирующих последовательностей человека — псевдогены, копии генов, инактивированные в результате мутаций. Эти последовательности нечто вроде молекулярных ископаемых, хотя иногда они могут служить исходным материалом для дупликации и последующей дивергенции генов. Другой источник разнообразия белков в организме — это использование интронов в качестве «линий разреза и склеивания» вальтернативном сплайсинге. Наконец, некодирующие белок последовательности могут кодировать вспомогательные клеточные РНК, например, мРНК .Недавнее исследование транскрипции генома человека показало, что 10 % генома даёт начало полиаденилированным РНК, а исследование и генома мыши показало, что 62 % его транскрибируется.

Транскрипция и трансляция

Репликация

Деление клеток необходимо для размножения одноклеточного и роста многоклеточного организма, но до деления клетка должна удвоить геном, чтобы дочерние клетки содержали ту же генетическую информацию, что и исходная клетка. Из нескольких теоретически возможных механизмов удвоения (репликации) ДНК реализуется полуконсервативный. Две цепочки разделяются, а затем каждая недостающая комплементарная последовательность ДНК воспроизводится ферментом ДНК-полимеразой. Этот фермент строит полинуклеотидную цепь, находя правильное основание через комплементарное спаривание оснований и присоединяя его к растущей цепочке. ДНК-полимераза не может начинать новую цепь, а только лишь наращивать уже существующую, поэтому она нуждается в короткой цепочке нуклеотидов (праймере), синтезируемой праймазой. Так как ДНК-полимеразы могут строить цепочку только в направлении 5′ —> 3′, для копирования антипараллельных цепей используются разные механизмы.

Правила Чаргаффа

Пра́вила Ча́ргаффа — система эмпирически выявленных правил, описывающих количественные соотношения между различными типами азотистых оснований в ДНК. Были сформулированы в результате работы группы биохимика Эрвина Чаргаффа в 1949—1951 гг.

До работ группы Чаргаффа господствовала так называемая «тетрануклеотидная» теория, согласно которой ДНК состоит из повторяющихся белков по четыре разных азотистых основания (аденин, тимин, гуанин и цитозин). Чаргаффу и сотрудникам удалось разделить нуклеотиды ДНК при помощи бумажной хроматографии и определить точные количественные соотношения нуклеотидов разных типов. Они значительно отличались от эквимолярных, которых можно было бы ожидать, если бы все четыре основания были представлены в равных пропорциях. Соотношения, выявленные Чаргаффом для аденина (А), тимина (Т), гуанина (Г) и цитозина (Ц), оказались следующими:

1. Количество аденина равно количеству тимина, а гуанина — цитозину: А=Т, Г=Ц.

2. Количество пуринов равно количеству пиримидинов: А+Г=Т+Ц.

[1]

3. Количество оснований с аминогруппами в положении 6 равно количеству оснований с кетогруппами в положении 6: А+Ц=Г+Т.

Вместе с тем, соотношение (A+Т):(Г+Ц) может быть различным у ДНК разных видов. У одних преобладают пары АТ, в других — ГЦ.

Правила Чаргаффа, наряду с данными рентгеноструктурного анализа, сыграли решающую роль в расшифровке структуры ДНК Дж. Уотсоном и Фрэнсисом Криком.

1.Николаев А.Я. «Биологическая химия» 2007г.

[3]

2.Строев Е.А. «Биологическая химия» 1986г. с.24-58

3.Щербак И.Г. «Биологическая химия» 2005г. с.9-24

Генетический код

Первые представления о том, каким образом в генах закодирована наследственная информация, изложил Ф. Крик в своей «гипотезе последовательности», согласно которой последовательность аминокислот в полипептидной цепи определяется последовательностью элементов в гене. Экспериментальные подтверждения данная гипотеза получила уже после расшифровки генетического кода в экспериментах Ч. Яновского. Чарльз Яновский в 1964 г. показал совпадение относительного положения индуцированных мутаций в гене trpA E.coli и аминокислотных замен в кодируемом этим геном ферменте — триптофан-синтетазе. Таким образом, была доказана колинеарностьструктуры гена и кодируемого им полипептида.

Тем не менее молекулярные основы этой колинеарности были вовсе не очевидны, поскольку все разнообразие аминокислот в полипептидах описывается значением 20, а разнообразие нуклеотидов в ДНК —значением 4. Таким образом, один нуклеотид никак не может кодировать одну аминокислоту в пептиде.

Эксперименты Ф. Крика и его соавторов по исследованию мутаций у бактериофага Т4 кишечной палочки позволили прийти к заключению, что каждая аминокислота кодируется тремя нуклеотидами, т. е. генетический код триплетный. Этот вывод следовал из наблюдения, что мутации, сопровождающиеся вставками или выпадениями (делециями) одного либо двух нуклеотидов из генома Т4, приводили к образованию аномальных белков с нарушенной функцией. Наоборот, вставки или делеции трех нуклеотидов сопровождались часто незначительными изменениями в составе белков, в результате чего последние сохраняли активность. Крик и Бреннер заключили, что генетический код считывается дискретными единицами по 3 нуклеотида. В таком случае вставка (делеция) триплета нуклеотидов должна приводить к добавлению (изъятию) всего одной аминокислоты из состава соответствующего полипептида. В ситуации, когда вставка (делеция) нуклеотидов совершается в количестве, не кратном трем, должен происходить сдвиг «рамки считывания» и последовательность аминокислот в белке должна полностью меняться.

Таким образом, генетический код — триплетный, т. е. положение каждой аминокислоты в полипептиде задается последовательностью из трех нуклеотидов, которая носит название кодон. Поскольку число разных нуклеотидов в ДНК равно четырем, то количество возможных вариантов триплетов нуклеотидов будет описываться количеством: 4 *4 * 4 = 64. 61 из 64 триплетов кодируют аминокислоты, причем каждый триплет — только одну аминокислоту, а три оставшихся кодона служат сигналами окончания (терминации) трансляции (рис. 1.7). Эти кодоны называют стоп (stop)-кодонами или нонсенс-кодонами, поскольку они не определяют никакой аминокислоты. Помимо этого, два кодирующих триплета (чаще ATG — для Met, иногда GTG — для Val) выполняют двойную функцию: кодируют аминокислоты метионин или валин и служат стартовыми кодонами, на которых начинается процесс трансляции (рис. 1.7).

Читайте так же:  Роль витаминов в организме человека

Особенностью генетического кода является то, что в нем отсутствуют запятые, т. е. нет знаков, отделяющих один кодон от другого. При этом генетический код не перекрывается в пределах одной рамки считывания, а рамка считывания задается первым «читаемым» нуклеотидом (рис. 1.8). Максимальное количество рамок считывания в гене — 3, столько же, сколько и «букв» в коде.

Для большинства клеточных организмов характерна реализация лишь одной рамки считывания, в то время как у некоторых вирусов их может быть две или даже три.

Направление чтения закодированной записи осуществляется от 5’-конца к 3’-концу мРНК, являющейся транскриптом «+»-цепи ДНК, считанным с нее в направлении 5’ → 3’. Первый с 5’-конца кодон отвечает N-концевой аминокислоте полипептидной цепи. Следовательно, белки синтезируются от N-конца к С-концу (рис. 1.8).

Еще одним свойством генетического кода является его вырожденность. Это означает, что одна аминокислота может кодироваться более чем одним триплетом нуклеотидов. С другой стороны, код не является двусмысленным: каждый кодон кодирует только одну аминокислоту. Такая закономерность выражается в том, что если известна последовательность нуклеотидов в ДНК, то с ее помощью легко узнать последовательность аминокислот в белке; наоборот, известную последовательность аминокислот нельзя однозначно перевести в нуклеотидную последовательность ДНК. Вырожденность генетического кода, как правило, приводит к тому, что у кодонов, определяющих одну и ту же аминокислоту, реально распознаются только первые два нуклеотида, а третий может не иметь значения.

Для объяснения этого феномена Крик предложил гипотезу «качания» (от англ. wobble), которая впоследствии подтвердилась, и в настоящее время называется правилом неоднозначного соответствия. Согласно этому правилу, cоответствие третьего нуклеотида в кодоне мРНК первому нуклеотиду в антикодоне тРНК является нестрогим, поскольку часто первое положение в антикодоне тРНК занимает минорный нуклеотид, содержащий в качестве азотистого основания инозин. Инозин может образовывать водородные связи с урацилом, цитозином или аденином, находящимися в кодоне в третьем положении. Существование такого механизма позволяет клетке иметь меньше 61 разной тРНК, поскольку многие тРНК способны узнавать до трех кодонов.

Генетический код универсален. Это свойство кода состоит в том, что любая молекула мРНК при трансляции в клетке любого организма приведет к синтезу полипептида с одинаковой последовательностью аминокислот. Данное правило, однако, имеет исключения, которые касаются генетического кода ДНК митохондрий. Большей частью и здесь используется основной «генетический словарь», но, например, в митохондриях млекопитающих кодон UGA в мРНК «читается» как триптофан, и в пептид в соответствующее положение включается триптофан, в то время как в ядерной мРНК данный кодон служит стоп-кодоном (рис. 1.7) и на нем заканчивается процесс трансляции. Наоборот, в митохондриях млекопитающих триплеты нуклеотидов AGA и AGG прочитываются как сигналы терминации, а в ядре они кодируют аминокислоту аргинин. В митохондриях других организмов могут встречаться иные отклонения от универсального для ядерной ДНК генетического кода.

Структура триплетов нуклеотидов коррелирует с химическими свойствами кодируемых ими аминокислот. Так, все кодоны с уридилатом во втором положении кодируют аминокислоты с гидрофобной боковой цепью: фенилаланин, лейцин, изолейцин, валин, метионин. Если исключить терминирующие кодоны, то наличие аденилата во втором положении определяет полярную или заряженную боковую цепь (тирозин, гистидин, глютамин, аспарагин, лизин, глютаминовая и аспарагиновая кислоты) . К тому же кодоны для большинства гидрофобных аминокислот различаются только одним нуклеотидом (рис. 1.7). Аналогичная ситуация наблюдается и для кодонов серина и треонина (их боковые группы содержат гидроксил) или аланина и глицина (имеют наименее сложно устроенные боковые группы). Таким образом, генетический код устроен так, что при замене нуклеотидов даже в первой или второй позиции некоторых кодонов в полипептид включается структурно родственная aминокислота, сводя тем самым к минимуму нарушения во вторичной структуре белка.

Расшифровка генетического кода осуществлена Ниренбергом и Кораной в начале 60-х годов прошлого столетия. В ходе первых экспериментов в бесклеточную систему для синтеза белка, содержащую все необходимые компоненты, в качестве мРНК вносили искусственно синтезированные гомополинуклеотиды: полиуридилат, полицитидилат и др. Синтезированные в таких условиях полипептиды подвергали аминокислотному анализу и установили, что на мРНК, представляющей собой poly(U) (т. е. UUUUUU…), синтезируется полифенилаланин, на poly(С) — полипролин и т. д. Таким образом, можно было заключить, что триплет нуклеотидов UUU кодирует аминокислоту фенилаланин, а ССС — пролин. Окончательную расшифровку всех 64 кодонов удалось осуществить с использованием в бесклеточных системах трансляции синтетических полирибонуклеотидов с известными повторяющимися последовательностями. Эти регулярные сополимеры удалось получить благодаря комбинированию методов органического и ферментативного синтеза.

Видео удалено.
Видео (кликните для воспроизведения).

Не нашли то, что искали? Воспользуйтесь поиском:

Источники


  1. Eulenburg, А. Реальная энциклопедия практической медицины / Eulenburg А.. — М.: СПб: Медицина. Журнал Практическая медицина’ (В.С. Эттингеръ)’, 2007. — 55 c.

  2. Собянин, Ф.И. Основы теории физической культуры. 10-11 класс / Ф.И. Собянин. — М.: Книга по Требованию, 2015. — 152 c.

  3. Самая спортивная; Эксмо — Москва, 2012. — 118 c.
  4. Роза, Волкова Диабет в схемах и таблицах. Диетология и не только / Волкова Роза. — М.: АСТ, 2013. — 547 c.
Последовательности днк кодирующие аминокислоты
Оценка 5 проголосовавших: 1

ОСТАВЬТЕ ОТВЕТ

Please enter your comment!
Please enter your name here