Сколькими нуклеотидами кодируется аминокислота

Сегодня предлагаем ознакомится со статьей на тему: сколькими нуклеотидами кодируется аминокислота с профессиональным описанием и объяснением.

Сколькими нуклеотидами кодируется аминокислота

Представим, что белок состоит из 90 аминокислот. Сколько нуклеотидов одной полинуклеотидной цепи ДНК шифрует (кодирует) последовательность аминокислот в этом белке? Ответ запишите числом.

Чаще всего в качестве неверного ответа указывают, что белок, состоящий из 90 аминокислот, кодирует 90 нуклеотидов одной полинуклеотидной цепи ДНК.
Информация о первичной структуре белковых молекул содержится в молекуле ДНК. Исходя из особенностей генетического кода, одну аминокислоту кодирует триплет нуклеотидов ДНК. Таким образом, если белок состоит из 90 аминокислот, информация о нем закодирована в 90 нуклеотидных триплетах, следовательно общее количество нуклеотидов составит .

Сколькими нуклеотидами кодируется аминокислота

Это способ, с помощью которого информация о последовательности двадцати аминокислот закодирована с помощью последовательности четырех нуклеотидов.

Свойства генкода

1) Триплетность
Одна аминокислота кодируется тремя нуклеотидами. В ДНК они называются триплет, в иРНК – кодон, в тРНК – антикодон. Всего существует 64 триплета, 61 из них кодирует аминокислоты, а 3 являются стоп-сигналами – показывают рибосоме место, в котором надо прекратить синтез белка.

2) Вырожденность (избыточность)
Кодонов, кодирующих аминокислоты, существует 61, а аминокислот только 20, поэтому большинство аминокислот кодируются несколькими кодонами. Например, аминокислота аланин кодируется четырьмя кодонами – ГЦУ, ГЦЦ, ГЦА, ГЦГ. Исключение – метионин, он кодируется одним кодоном АУГ – у эукариот это старт-кодон при трансляции.

3) Однозначность
Каждый кодон кодирует только одну аминокислоту. Например, кодон ГЦУ кодирует только одну аминокислоту – аланин.

4) Непрерывность
Между отдельными триплетами нет никаких разделителей («знаков препинания»). Из-за этого при выпадении или вставке одного нуклеотида происходит «сдвиг рамки считывания»: начиная с места мутации считывание триплетного кода нарушается, синтезируется совершенно другой белок.

5) Универсальность
Генетический код одинаков для всех живых организмов на Земле.

[3]

Сколько нуклеотидов содержит ген ДНК, если в нем закодировано 135 аминокислот?

Промокод YouDrive: khCyy2 (50% скидка на первую поездку, но не более 500 руб)
Промокод Делимобиль: Refigh4 (400 рублей)
Промокод BelkaCar: AWKM9122 (300 рублей)
Промокод МатрёшCar: LSJIPO (300 рублей)

Задача 1. В белке содержится 51 аминокислота. Сколько нуклеотидов будет в цепи гена, кодирующей этот белок, и сколько — в соответствующем фрагменте молекулы ДНК?

Поскольку генетический код триплетен, т. е. одна аминокислота кодируется тремя нуклеотидами, то количество нуклеотидов в кодирующей цепи гена будет 51

× 3 = 153, а в двухцепочечной ДНК количество нуклеотидов будет вдвое больше, т. е. 153 × 2 = 306.

Ответ: в кодирующей цепи гена будет содержаться

153 нуклеотида, во фрагменте ДНК-306.

Задача 2. В кодирующей цепи гена содержится 600 нуклеотидов. Сколько аминокислот содержится в молекуле белка, информация о которой закодирована в этом гене, если в конце гена имеются два стоп — триплета?

1. Поскольку в конце гена имеются два стоп — кодона, то 6 нуклеотидов (2×3) не несут информации о структуре белка. Значит, информация о данном белке закодирована в цепочке из 594 (600 – 6) нуклеотидов.

2. Основываясь на триплетности кода, подсчитаем количество аминокислот: 594 : 3 = 198.

Ответ: в молекуле белка содержится 198

Задача 3. В белке содержится 25 аминокислот. Сколько нуклеотидов содержится в кодирующей цепи гена, если три «знака препинания» стоят в конце гена?

1.Определим количество нуклеотидов в кодирующей части соответствующей цепи гена: 25×3=75.

2. Поскольку каждый “знак препинания” содержит 3 нуклеотида, то общее количество нуклеотидов в кодирующей цепи гена составляет 75+3 × 3=84.

Промокод YouDrive: khCyy2 (50% скидка на первую поездку, но не более 500 руб)
Промокод Делимобиль: Refigh4 (400 рублей)
Промокод BelkaCar: AWKM9122 (300 рублей)
Промокод МатрёшCar: LSJIPO (300 рублей)

Ответ: в кодирующей цепи гена содержится 84

Задача 4. Длина фрагмента молекулы ДНК бактерии равняется 20,4 нм. Сколько аминокислот будет в белке, кодируемом данным фрагментом ДНК?

1. Определим число нуклеотидов в кодирующей цепи гена: 20,4 нм : 0,34 нм = 60.

2. Исходя из триплетности кода определяем количество аминокислот в белке: 60 :3 = 20.

Ответ: в белке будет 20 аминокислот.

Задача 5. Длина гена 34,68 нм. Какова масса молекулы белка, кодируемой данным геном, если по одному регуляторному триплету находится в начале и в

конце гена, длина одного нуклеотида — 0,34 нм, а масса одной аминокислоты — 100 а. е.?

1. Находим количество нуклеотидов в кодирующей цепи гена: 34,68 нм: 0,34 нм = 102.

2. Учитывая, что по одному регуляторному триплету находится в начале и в конце кодирующей цепи гена, находим количество нуклеотидов, несущих информацию о структуре белка: 102 – 2 × 3 = 96.

3. Зная, что за каждую аминокислоту отвечает один триплет нуклеотидов, определяем количество аминокислот в молекуле белка: 96 : 3 = 32.

4. Находим массу белковой молекулы: 100 а. е.× 32=3200 а.е.

Ответ: масса белковой молекулы 3200 а. е.

Дата добавления: 2014-11-12 , просмотров: 2282 . Нарушение авторских прав

  • http://studopedia.info/1-71777.html

Смотрите видео: Участок цепочки ДНК бактериофага лямбда содержит 23 нуклеотида с тимином

Промокод YouDrive: khCyy2 (50% скидка на первую поездку, но не более 500 руб)
Промокод Делимобиль: Refigh4 (400 рублей)
Промокод BelkaCar: AWKM9122 (300 рублей)
Промокод МатрёшCar: LSJIPO (300 рублей)

сколько нуклеотидов кодируют 1 аминокислоту

3 нуклеотида. Их еще называют кодоном.

Другие вопросы из категории

фенотипически таких же родительских особей все потомство получилось черное хохлатое. составьте схемы скрещивания. какие законы проявляются в данных скрещиваниях

опыт ван Гельмонта, когда взяв 200 фунтов сухой земли и ивовую ветвь весом 5
фунтов, выращивал её, поливая только дождевой водой. Вес ивы через 5 лет
составлял 164 фунта, а вес земли уменьшился всего на 2 унции. Ван Гельмонт
сделал ошибочный вывод, что материал, из которого образовалось дерево,
произошёл из воды, использованной для полива. А какое объяснение результату
опыта ван Гельмонта дадите вы?

Читайте так же:  Список жиросжигателей для женщин

Установите, в какой последовательности появились на суше основные группы растений.
а)покрытосеменные.
б)споровые папоротники.
в)голосеменные.
г)семенные папоротники.
д)псилофиты.

Читайте также

А)ПЕРЕНОСИТ ИНФОРМАЦИЮ НА РИБОСОМЫ

Б)место синтеза белка

в) фермент обеспечивающий синтез и-РНК

г)источник энергии для реакции

е)группа нуклеотидов кодирующих одну аминокислоту

ж)ген кодирующий информацию о белке

з)группа рибосом место сборки белков

-А-Ц-А-А-Т-А-А-А-А-Г-Т-Т-Т-Т-А-А-Ц-А-Г-Г-А-Г-Ц-А-Ц-Ц-А-. определите сколько нуклеотидов и триплетов в ДНК и какова длина гена, кодирующего синтез вазопрессина.

нуклеотидов с гуанином (Г). Сколько нуклеотидов с тимином, аденином, цитозином и гуанином содержится в 2-х цепях молекулы ДНК? Сколько аминокислот кодирует этот участок молекулы ДНК?

нуклеотидами в ДНК составляет 0,34 нм)? Какое время понадобится для синтеза этого белка, если скорость передвижения рибосомы по и-РНК составляет 6 триплетов в секунду?

Фрагмент цепи иРНК имеет последовательность нуклеотидов: ЦЦЦАЦЦГЦАГУА. Определите последовательность нуклеотидов на ДНК, антикодоны тРНК и последовательность аминокислот во фрагменте молекулы белка, используя таблицу генетического кода.

Задача № 2. Фрагмент цепи ДНК имеет следующую последовательность нуклеотидов: ТАЦЦЦТЦАЦТТГ. Определите последовательность нуклеотидов на иРНК, антикодоны соответствующих тРНК и аминокислотную последовательность соответствующего фрагмента молекулы белка, используя таблицу генетического кода.

Задача № 3
Последовательность нуклеотидов фрагмента цепи ДНК ААТГЦАГГТЦАЦТЦА. Определите последовательность нуклеотидов в и-РНК, аминокислот в полипептидной цепи. Что произойдет в полипептиде, если в результате мутации во фрагменте гена выпадет второй триплет нуклеотидов? Используйте таблицу гент.кода
Практикум-решение задач по теме « Биосинтез белка» (10 класс)

Известно, что все виды РНК синтезируются на ДНК-матрице. Фрагмент молекулы ДНК, на котором синтезируется участок центральной петли т-РНК, имеет следующую последовательность нуклеотидов: АТАГЦТГААЦГГАЦТ. Установите нуклеотидную последовательность участка т-РНК, который синтезируется на данном фрагменте, и аминокислоту, которую будет переносить эта т-РНК в процессе биосинтеза белка, если третий триплет соответствует антикодону т-РНК. Ответ поясните. Для решения задания используйте таблицу генетического кода.

Расчетные задачи, посвященные определению количества аминокислот в белке, а также количеству нуклеотидов и триплетов в ДНК или РНК.

Общие рекомендации.

Основные моменты, которые необходимо помнить при решения задач по цитологии.

1) Каждая аминокислота доставляется к рибосомам одной тРНК, следовательно, количество аминокислот в белке равно количе­ству молекул тРНК, участвовавших в синтезе белка;

2) каждая аминокислота кодируется тремя нуклеотидами (одним триплетом, или кодоном), поэтому количество кодирующих ну­клеотидов всегда в три раза больше, а количество триплетов (ко­донов) равно количеству аминокислот в белке;

3) каждая тРНК имеет антикодон, комплементарный кодону иРНК, поэтому количество антикодонов, а значит и в целом молекул тРНКравно количеству кодонов иРНК;

4) иРНК комплементарна одной из цепей ДНК, поэтому количество нуклеотидов иРНК равно количеству нуклеотидов ДНК. Количе­ство триплетов, разумеется, также будет одинаковым.

При решении ряда задач данного раздела необходимо пользо­ваться таблицей генетического кода. Правила пользования таб­лицей обычно указываются в задании, но лучше научиться это­му заранее. Для определения аминокислоты, кодируемой тем или иным триплетом, необходимо выполнить следующие действия:

1) первый нуклеотид триплета находим в левом вертикальном ряду,

2) второй — в верхнем горизонтальном,

3) третий — в правом верти­кальном ряду.

4) соответствующая триплету аминокислота находится в точке пересе­чения воображаемых линий, идущих от нуклеотидов.

Письменное оформление решения задач.

Решение:

Определить:

Ответ:

Важным момен­том при решении заданий является объяснение выполняемых действий, особенно если в задаче так и написано: «Ответ поясни­те». Наличие пояснений позволяет проверяющему сделать вывод о понимании учащимся данной темы, а их отсутствие может при­вести к потере очень важного балла. Задание 39 оценивается в три балла, которые начисляются в случае полностью верного решения. Поэтому, приступая к задаче, в первую очередь необходимо выделить все вопросы. Количество ответов должно им соответствовать.

Типы задач по цитологии.

Задачи, связаные с определением процентного содержания нуклеотидов в ДНК

Еще до открытия Уотсона и Крика, в 1950 г. австралийский биохимик Эдвин Чаргафф установил, что в ДНК любого организма количество адениловых нуклеотидов равно количеству тимидиловых, а количество гуаниловых нуклеотидов равно количеству цитозиловых нуклеотидов (А=Т, Г=Ц), или суммарное количество пуриновых азотистых оснований равно суммарному количеству пиримидиновых азотистых оснований (А+Г=Ц+Т). Эти закономерности получили название «правила Чаргаффа».

Дело в том, что при образовании двойной спирали всегда напротив азотистого основания аденин в одной цепи устанавливается азотистое основание тимин в другой цепи, а напротив гуанина – цитозин, то есть цепи ДНК как бы дополняют друг друга. А эти парные нуклеотиды комплементарны друг другу (от лат. complementum – дополнение).

Почему же этот принцип соблюдается? Чтобы ответить на этот вопрос, нужно вспомнить о химической природе азотистых гетероциклических оснований. Аденин и гуанин относятся к пуринам, а цитозин и тимин – к пиримидинам, то есть между азотистыми основаниями одной природы связи не устанавливаются. К тому же комплементарные основания соответствуют друг другу геометрически, т.е. по размерам и форме. Таким образом, комплементарность нуклеотидов – это химическое и геометрическое соответствие структур их молекул друг другу.

В азотистых основаниях имеются сильноэлектроотрицательные атомы кислорода и азота, которые несут частичный отрицательный заряд, а также атомы водорода, на которых возникает частичный положительный заряд. За счет этих частичных зарядов возникают водородные связи между азотистыми основаниями антипараллельных последовательностей молекулы ДНК.

Задача. В молекуле ДНК насчитывается 23% адениловых нуклеотидов от общего числа нуклеотидов. Определите количество тимидиловых и цитозиловых нуклеотидов.

Дано: В молекуле ДНК – 23% адениловых нуклеотидов

Решение:

1. По правилу Чаргаффа находим содержание тимидиловых нуклеотидов в данной молекуле ДНК: А=Т=23%.

2. Находим сумму (в %) содержания адениловых и тимидиловых нуклеотидов в данной молекуле ДНК: 23% + 23% = 46%.

3. Находим сумму (в %) содержания гуаниловых и цитозиловых нуклеотидов в данной молекуле ДНК: 100% – 46% = 54%.

4. По правилу Чаргаффа, в молекуле ДНК Г=Ц, в сумме на их долю приходится 54%, а по отдельности: 54% : 2 = 27%.

Определить: Количество тимидиловых и цитозиловых нуклеотидов.

Ответ: Т=23%; Ц=27%

Расчетные задачи, посвященные определению количества аминокислот в белке, а также количеству нуклеотидов и триплетов в ДНК или РНК.

Читайте так же:  Аминокислоты входящие в состав молекулы белка

Аминокислоты, необходимые для синтеза белка, доставляются в рибосомы с помощью т-РНК. Каждая молекула т-РНК переносит только одну аминокислоту.

Информация о первичной структуре молекулы белка зашифрована в молекуле ДНК.

Каждая аминокислота зашифрована последовательностью из трех нуклеотидов. Эта последовательность называется триплетом или кодоном.

Задача: в трансляции участвовало 30 молекул т-РНК. Определите количество аминокислот, входящих в состав образующегося белка, а также число триплетов и нуклеотидов в гене, который кодирует этот белок.

Дано: Кол-во т-РНК — 30

Решение:

1. Если в синтезе участвовало 30 т-РНК, то они перенесли 30 аминокислот.

2. Одна аминокислота кодируется одним триплетом, значит число триплетов -30

3. Один триплет – 3 нуклеотида, 3х30=90 нуклеотидов

Определить: Кол-во а/к Число триплетов Число нуклеотидов

Ответ: Кол-во а/к – 30. Число триплетов – 30. Число нуклеотидов – 90.

Дата добавления: 2018-05-12 ; просмотров: 472 ; ЗАКАЗАТЬ РАБОТУ

сколько нуклеотидов кодируют 1 аминокислоту

3 нуклеотида. Их еще называют кодоном.

Другие вопросы из категории

фенотипически таких же родительских особей все потомство получилось черное хохлатое. составьте схемы скрещивания. какие законы проявляются в данных скрещиваниях

опыт ван Гельмонта, когда взяв 200 фунтов сухой земли и ивовую ветвь весом 5
фунтов, выращивал её, поливая только дождевой водой. Вес ивы через 5 лет
составлял 164 фунта, а вес земли уменьшился всего на 2 унции. Ван Гельмонт
сделал ошибочный вывод, что материал, из которого образовалось дерево,
произошёл из воды, использованной для полива. А какое объяснение результату
опыта ван Гельмонта дадите вы?

Установите, в какой последовательности появились на суше основные группы растений.
а)покрытосеменные.
б)споровые папоротники.
в)голосеменные.
г)семенные папоротники.
д)псилофиты.

Читайте также

А)ПЕРЕНОСИТ ИНФОРМАЦИЮ НА РИБОСОМЫ

Б)место синтеза белка

в) фермент обеспечивающий синтез и-РНК

г)источник энергии для реакции

е)группа нуклеотидов кодирующих одну аминокислоту

ж)ген кодирующий информацию о белке

з)группа рибосом место сборки белков

-А-Ц-А-А-Т-А-А-А-А-Г-Т-Т-Т-Т-А-А-Ц-А-Г-Г-А-Г-Ц-А-Ц-Ц-А-. определите сколько нуклеотидов и триплетов в ДНК и какова длина гена, кодирующего синтез вазопрессина.

нуклеотидов с гуанином (Г). Сколько нуклеотидов с тимином, аденином, цитозином и гуанином содержится в 2-х цепях молекулы ДНК? Сколько аминокислот кодирует этот участок молекулы ДНК?

нуклеотидами в ДНК составляет 0,34 нм)? Какое время понадобится для синтеза этого белка, если скорость передвижения рибосомы по и-РНК составляет 6 триплетов в секунду?

Фрагмент цепи иРНК имеет последовательность нуклеотидов: ЦЦЦАЦЦГЦАГУА. Определите последовательность нуклеотидов на ДНК, антикодоны тРНК и последовательность аминокислот во фрагменте молекулы белка, используя таблицу генетического кода.

Задача № 2. Фрагмент цепи ДНК имеет следующую последовательность нуклеотидов: ТАЦЦЦТЦАЦТТГ. Определите последовательность нуклеотидов на иРНК, антикодоны соответствующих тРНК и аминокислотную последовательность соответствующего фрагмента молекулы белка, используя таблицу генетического кода.

Задача № 3
Последовательность нуклеотидов фрагмента цепи ДНК ААТГЦАГГТЦАЦТЦА. Определите последовательность нуклеотидов в и-РНК, аминокислот в полипептидной цепи. Что произойдет в полипептиде, если в результате мутации во фрагменте гена выпадет второй триплет нуклеотидов? Используйте таблицу гент.кода
Практикум-решение задач по теме « Биосинтез белка» (10 класс)

Известно, что все виды РНК синтезируются на ДНК-матрице. Фрагмент молекулы ДНК, на котором синтезируется участок центральной петли т-РНК, имеет следующую последовательность нуклеотидов: АТАГЦТГААЦГГАЦТ. Установите нуклеотидную последовательность участка т-РНК, который синтезируется на данном фрагменте, и аминокислоту, которую будет переносить эта т-РНК в процессе биосинтеза белка, если третий триплет соответствует антикодону т-РНК. Ответ поясните. Для решения задания используйте таблицу генетического кода.

Сколькими нуклеотидами кодируется аминокислота

Небольшой экскурс в историю кодов можно прочитать здесь: Общие свойства кодов

СВОЙСТВА ГЕНЕТИЧЕСКОГО КОДА

Проектное задание с кубиками и

поздравление с праздником.

Для «перевода» с языка азотистых оснований нуклеиновых кислот (ДНК и РНК) на язык белков (последовательность аминокислот в полипептидной цепи) можно воспользоваться Таблицей генетического кода или онлайновой машиной-переводчиком ( EMBOSS Transeq ), созданной в Европейском институте биоинформатитки (European Bioinformatics Institute). Протеиновая машина расположена по адресу http://www.ebi.ac.uk/Tools/st/emboss_transeq/. На рисунке ниже представлена рабочая часть машины-переводчика.

Под названием вы видите ссылку на таблицу генетического кода, список для выбора типа кода (по умолчанию — Standard, об этом списке см. ниже) и поле для ввода последовательности нуклеотидов ДНК (Enter or Paste a nucleic acid Sequence). Перевод осуществляется нажатием на расположенную ниже кнопку Run.

При этом программа переходит на новую страницу, на которой представлены условия выбора и результаты ее работы — создана последовательность аминокислот полипептида, закодированная введенной вами иР НК.
При этом указывается, из скольких звеньев состояла иР НК, сколько аминокислот в полипептидной цепочке, что это за аминокислоты ( RDLCCVX — последовательность Аргинин — Аспарагиновая кислота — Лейцин — Цистеин — Цистеин — Валин, см. условные обозначения).
Выбор в стартовом окне в списке Colour позволяет (на новой странице с отчетом) увидеть полипептидную цепь, в которой отдельные аминокислоты имеют разный цвет в зависимости от их свойств. Выбор в списке Reverse позволяет определить аминокислотную последовательность не по иРНК (или по комплементарной нити ДНК) , а по смысловой нити ДНК. В списке Region определяется, с какого нуклеотида надо начинать считывание информации (с первого в триплете или с другого).

1. Триплетность — каждая аминокислота кодируется тремя нуклеотидами. Три нуклеотида, являющиеся единицей кода, называются триплетом, или кодоном.
Генетический код не может быть одинарным, т.к. нуклеотидов ДНК всего 4, а аминокислот — 20.
Кодировать аминокислоты двумя нуклеотидами каждую также недостаточно, т.к. возможно только 4 2 = 16 вариантов. Следующий логически вариант — кодировать аминокислоту тремя нуклеотидами, т.к. возможно 4 3 = 64 варианта.

Откройте страницу EMBOSS Transeq, скопируйте через буфер обмена приведенную ниже последовательность нуклеотидов в окно Enter or Paste a nucleic acid Sequence
auguccagagcauacccguauucu
или наберите в нем свою последовательность, и переведите приведенную последовательность в белок, нажав кнопку кнопку Run.

2. Триплеты не отграничены друг от друга, но есть сочетания нуклеотидов, обозначающих «точку», конец считывания — «стоп-кодоны» .

Переведите с помощью EMBOSS Transeq приведенную ниже последовательность в белок. Обратите внимание, что фрагмент состоит из 24 мономеров. Сколько аминокислот в пептиде? Вывод — что обозначает * ?
auguacccguauuccagagcauag

Откройте таблицу генетического кода и найдите в ней стоп-кодоны. Какие сочетания нуклеотидов их кодируют?

3. Вырожденность — одна аминокислота может кодироваться несколькими разными триплетами.
Вырожденность является следствием триплетности кода, т.к. четыре нуклеотида, взятые по 3, могут закодировать 4 3 = 64 разных объекта, тогда как аминокислот всего 20 . Убедимся на примере.

Читайте так же:  Л карнитин внешторг фарма

Ниже приведены две последовательности нуклеотидов, различающиеся между собой по 11 позициям из 18. Переведите с помощью EMBOSS Transeq обе последовательности в белки. Сколько аминокислотных различий между ними?
1) augucuagauuaggcuca 2) augagccggcucggaagu

4. Универсальность — генетический код одинаков для всех живых организмов на Земле, т.е. в клетке любого из существ одинаковая последовательность нуклеотидов будет кодировать ту же аминокислоту (см. рис. слева внизу).
Впрочем, правильнее утверждать, что генетический код практически универсален, т.к. в некоторых генетических системах (например, в генах митохондрий и хлоропластов) есть некоторые отличия от стандартного кода, присущего организмам.

Переведите с помощью EMBOSS Transeq приведенную ниже последовательность в белок, используя основной (Standard) вариант кода. Запишите полученный белок.
uacagacccauaugcgguacuuga

Вернитесь к стартовой странице EMBOSS Transeq и откройте список (красная стрелка на рисунке ниже), а в нем выберите второй вариант кода — Vertebrate Mitochondrial (2).

Снова введите в окно для ДНК ту же последовательность нуклеотидов (или воспользуйтесь уже введенной, если вернулись на страницу с помощью «Назад» браузера). Запишите полученный белок и сравните с полученным ранее.
Поэкспериментируйте с кодами других генетических систем.

Как Вы думаете, какое значение для организмов имеет то, что генетический код клеток и митохондрий различен? Каковы причины этого?

Перевод одного и того же фрагмента разными кодами позволяет решить несколько олимпиадных задач:

1. Полную последовательность нуклеотидов и-РНК со всеми кодонам перевести каждым из кодов и построить филогенетическое древо кодов по полученным аминокислотным последовательностям (и положению стоп-кодонов). В результате может получиться, например, такое древо (спасибо Statistica for Windows ) .
2. Показав различия между кодами разных генетических систем, постарайтесь найти подтверждения теории, по которой исторически более ранним был вариант кода с двумя значимыми нуклеотидами и третьим-разделителем.
Видео удалено.
Видео (кликните для воспроизведения).

5. Неперекрываемость : каждый участок ДНК хранит информацию не более чем об одном белке. Иными словами, если участок ДНК кодирует белок, то не может кодировать (начиная с какого-нибудь другого нуклеотида) другой белок.

Переведите с помощью EMBOSS Transeq приведенную ниже последовательность в белок. Запишите полученный белок. А теперь попробуйте удалить первые два нуклеотида и получить другой пептид, представив, что генетический перекрывается. Запишите полученный пептид и сравните с первым.
uaugcuaagauuccuuucgga

Правильнее утверждать, что генетический код практически неперекрываемый, т.к. у вирусов, у которых большое количество информации должно поместиться в небольшом фрагменте, наблюдается двойное, а у фага f Х 147 — даже тройное перекрывание (небольшой участок входит одновременно в 3 разных гена).

[2]

Что имеет большую массу — белок или кодирующий его структурный ген? Решите задачу: 1) для глюкагона, состоящего из 29 аминокислотных остатков; 2) в общем виде — для белка из N аминокислотных остатков (вспомни, какое свойство генетического кода лежит в основе задачи).

Теперь, когда ты стал опытным дешифровщиком, попробуй решить обратную задачу: по молекуле белка восстановить состав (точнее, один из возможных вариантов — вспомни, какое свойство генетического кода делает ответ неоднозначным)
Аминокислоты : Метионин — Аргинин — Лизин — Валин — Триптофан — (стоп-кодон)
Видимо, стОит воспользоваться таблицей генетического кода.

M S R L GS

M S * L GS

Обратитесь к текстовой иллюстрации свойств кода и точковых мутаций (пример взят из «Основ современной генетики» С.М. Гершензона + пример на английском языке из Hocking S. OCR A2 Biology Student Book) — файл Иллюстрация свойств кода. Придумайте собственную фразу из трехбуквенных слов, которая бы иллюстрировала все свойства генетического кода); перекрываемость генетического кода у вирусов; различия в общем и митохондриальном кодах. Как это можно проиллюстрировать?

Проектное задание
На рисунке слева — кубики аминокислот с кодонами. Это неплохое проектное задание для 10-классников: сделать такой конструктор для учеников 9 класса, знакомящихся с биосинтезом белка впервые (только сделать всё по уму, с антикодонами т-РНК). Заодно предложите подумать над таким вопросом:
Чтение и ферменты

В описании биосинтеза белка лингвистические аналогии достаточно распространены. Транскрипция знакома по изучению английского: запись произношения того же слова на том же языке, но чуть иными символами и с иной целью. Трансляция и вовсе «перевод»: с языка нуклеотидов на язык аминокислот. Это, так сказать, эпический зачин.
Обслуживают все процессы биосинтеза белка различные ферменты: РНК-полимеразы, аминоацил-т-РНК-синтетазы, ДНК-гиразы и т.д., и т.п. Вопрос: какой (какие) из этих ферментов умеют читать , т.е. понимают смысл того текста, который переводят?
Можно не спешить с ответом, а подождать до темы о регуляции генной активности.
См. также кодо-додекаэдр.

Закодированное поздравление

Приведенная ниже последовательность является поздравлением с праздником. Перекодируйте с языка оснований ДНК на язык аминокислот, чтобы узнать, с каким:

Генетический код. Это система кодирования последовательности аминокислот белка в виде определенной последовательности нуклеотидов в ДНК и РНК

Это система кодирования последовательности аминокислот белка в виде определенной последовательности нуклеотидов в ДНК и РНК.

Единица генетического кода (кодон) — это триплет нуклеоти­дов в ДНК или РНК, кодирующий одну аминокислоту.

Всего генетический код включает 64 кодона, из них 61 коди­рующий и 3 некодирующих (кодоны-терминаторы, свидетель­ствующие об окончании процесса трансляции).

Кодоны-терминаторы в и-РНК: УАА, УАГ, УГА, в ДНК: АТТ, АТЦ, АЦТ.

Начало процесса трансляции определяет кодон-инициатор (АУГ, в ДНК — ТАЦ), кодирующий аминокислоту метионин. Этот кодон первым входит в рибосому. Впоследствии метионин, если он не предусмотрен в качестве первой аминокислоты данно­го белка, отщепляется.

Генетический код обладает характерными свойствами.

1. Универсальность — код одинаков для всех организмов. Один и тот же триплет (кодон) в любом организме кодирует одну и ту же аминокислоту.

2. Специфичность — каждый кодон шифрует только одну аминокислоту.

3. Вырожденность — большинство аминокислот могут коди­роваться несколькими кодонами. Исключение составляют 2 амино­кислоты — метионин и триптофан, имеющие лишь по одному ва­рианту кодона.

4. Между генами имеются «знаки препинания» — три специаль­ных триплета (УАА, УАГ, УГА), каждый из которых обозначает прекращение синтеза полипептидной цепи.

5. Внутри гена «знаков препинания» нет.

Не нашли то, что искали? Воспользуйтесь поиском:

Лучшие изречения: На стипендию можно купить что-нибудь, но не больше. 8784 —

Читайте так же:  Ошибки при использовании спортпита
| 7163 — или читать все.

185.189.13.12 © studopedia.ru Не является автором материалов, которые размещены. Но предоставляет возможность бесплатного использования. Есть нарушение авторского права? Напишите нам | Обратная связь.

Отключите adBlock!
и обновите страницу (F5)

очень нужно

Решение задач второго типа. Определение количества аминокислот в белке, нуклеотидов и триплетов в ДНК и РНК.

Справочная информация:

Аминокислоты, необходимые для синтеза белка, доставляются в рибосомы с помощью т-РНК. Каждая молекула т-РНК переносит только одну аминокислоту.

Информация о первичной структуре молекулы белка зашифрована в молекуле ДНК.

Каждая аминокислота зашифрована последовательностью из трех нуклеотидов. Эта последовательность называется триплетом или кодоном.

Пример 1. В про­цес­се транс­ля­ции участ­во­ва­ло 30 мо­ле­кул т-РНК. Опре­де­ли­те число ами­но­кис­лот, вхо­дя­щих в со­став син­те­зи­ру­е­мо­го белка, а также число три­пле­тов и нук­лео­ти­дов в гене, ко­то­рый ко­ди­ру­ет этот белок.

Элементы ответа:

1) Одна т-РНК транс­пор­ти­ру­ет одну ами­но­кис­ло­ту. Так как в син­те­зе белка участ­во­ва­ло 30 т-РНК, белок со­сто­ит из 30 ами­но­кис­лот.

2) Одну ами­но­кис­ло­ту ко­ди­ру­ет три­плет нук­лео­ти­дов, зна­чит, 30 ами­но­кис­лот ко­ди­ру­ет 30 три­пле­тов.

3) Три­плет со­сто­ит из 3 нук­лео­ти­дов, зна­чит ко­ли­че­ство нук­лео­ти­дов в гене, ко­ди­ру­ю­щем белок из 30 ами­но­кис­лот, равно 30х3=90.

Пример 2. В био­син­те­зе по­ли­пеп­ти­да участ­ву­ют мо­ле­ку­лы т-РНК с ан­ти­ко­до­на­ми УГА, АУГ, АГУ, ГГЦ, ААУ. Опре­де­ли­те нук­лео­тид­ную по­сле­до­ва­тель­ность участ­ка каж­дой цепи мо­ле­ку­лы ДНК, ко­то­рый несет ин­фор­ма­цию о син­те­зи­ру­е­мом по­ли­пеп­ти­де, и число нук­лео­ти­дов, со­дер­жа­щих аде­нин (А), гу­а­нин (Г), тимин (Т), ци­то­зин (Ц) в двух­це­по­чеч­ной мо­ле­ку­ле ДНК. Ответ по­яс­ни­те.

Элементы ответа:

1) и-РНК: АЦУ – УАЦ – УЦА – ЦЦГ – УУА (по прин­ци­пу ком­пле­мен­тар­но­сти).

2) ДНК: 1-ая цепь: ТГА – АТГ – АГТ – ГГЦ – ААТ

2-ая цепь: АЦТ – ТАЦ –ТЦА –ЦЦГ — ТТА

3) ко­ли­че­ство нук­лео­ти­дов: А — 9 (30%), Т — 9 (30%),

так как А=Т; Г — 6 (20%), Ц — 6 (20%), так как Г=Ц.

Пример 3.и-РНК со­сто­ит из 156 нук­лео­ти­дов. Опре­де­ли­те число ами­но­кис­лот, вхо­дя­щих в ко­ди­ру­е­мый ею белок, число мо­ле­кул т-РНК, участ­ву­ю­щих в про­цес­се био­син­те­за этого белка, и ко­ли­че­ство три­пле­тов в гене, ко­ди­ру­ю­щем пер­вич­ную струк­ту­ру белка. Объ­яс­ни­те по­лу­чен­ные ре­зуль­та­ты.

Элементы ответа:

1. Белок со­дер­жит 52 ами­но­кис­ло­ты, т. к. одну ами­но­кис­ло­ту ко­ди­ру­ет один три­плет (156:3).

2. т-РНК транс­пор­ти­ру­ет к месту син­те­за белка одну ами­но­кис­ло­ту, сле­до­ва­тель­но, всего в син­те­зе участ­ву­ют 52 т-РНК.

3. В гене пер­вич­ную струк­ту­ру белка ко­ди­ру­ют 52 три­пле­та, так как каж­дая ами­но­кис­ло­та ко­ди­ру­ет­ся одним три­пле­том.

Пример 4. Ген со­дер­жит 1500 нук­лео­ти­дов. В одной из цепей со­дер­жит­ся 150 нук­лео­ти­дов А, 200 нук­лео­ти­дов Т, 250 нук­лео­ти­дов Г и 150 нук­лео­ти­дов Ц. Сколь­ко нук­лео­ти­дов каж­до­го вида будет в цепи ДНК, ко­ди­ру­ю­щей белок? Сколь­ко ами­но­кис­лот будет за­ко­ди­ро­ва­но дан­ным фраг­мен­том ДНК?

[1]

Элементы ответа:

1) В ко­ди­ру­ю­щей цепи ДНК в со­от­вет­ствии с пра­ви­лом ком­пле­мен­тар­но­сти нук­лео­ти­дов будет со­дер­жать­ся: нук­лео­ти­да Т — 150, нук­лео­ти­да А — 200, нук­лео­ти­да Ц — 250, нук­лео­ти­да Г — 150. Таким об­ра­зом, всего А и Т по 350 нук­лео­ти­дов, Г и Ц по 400 нук­лео­ти­дов.

2) Белок ко­ди­ру­ет­ся одной из цепей ДНК.

3) По­сколь­ку в каж­дой из цепей 1500/2=750 нук­лео­ти­дов, в ней 750/3=250 три­пле­тов. Сле­до­ва­тель­но, этот уча­сток ДНК ко­ди­ру­ет 250 ами­но­кис­лот.

Пример 5. Фрагмент молекулы и-РНК состоит из 87 нуклеотидов. Определите число нуклеотидов двойной цепи ДНК, число триплетов матричной цепи ДНК и число нуклеотидов в антикодонах всех т-РНК, которые участвуют в синтезе белка. Ответ поясните.

Элементы ответа:

1) двойная цепь ДНК содержит 87 х 2 = 174 нуклеотида, так как молекула ДНК состоит из двух цепей;

2) матричная цепь ДНК содержит 87: 3 = 29 триплетов, так как триплет содержит три нуклеотида;

3) в антикодонах всех т-РНК содержится 87 нуклеотидов.

Пример 6.Сколько нуклеотидов содержит ген (обе цепи ДНК), в котором запрограммирован белок из 520 аминокислот? Какую он имеет длину (расстояние между нуклеотидами в ДНК составляет 0,34 нм)? Какое время понадобиться для синтеза этого белка, если скорость передвижения рибосомы по и-РНК составляет 6 триплетов в секунду?

Элементы ответа:

1) одну аминокислоту кодирует тройка нуклеотидов — число нуклеотидов в двух цепях: 520 х 3 х 2 = 3120;

2) длина гена: 1560 х 0,34 = 530,4 нм (определяется по одной цепи, так как цепи располагаются параллельно);

3) время синтеза: 1560 : 6 = 260 с (4,3 мин.).

Не нашли то, что искали? Воспользуйтесь поиском:

Лучшие изречения: Сдача сессии и защита диплома — страшная бессонница, которая потом кажется страшным сном. 8599 —

| 7071 — или читать все.

185.189.13.12 © studopedia.ru Не является автором материалов, которые размещены. Но предоставляет возможность бесплатного использования. Есть нарушение авторского права? Напишите нам | Обратная связь.

Отключите adBlock!
и обновите страницу (F5)

очень нужно

Решение задач по биологии и химии

составляет 18% от количества всех нуклеотидов, а длина одного нуклеотида 0,34 нм?

9. Каков нуклеотидный состав ДНК, если в и-РНК содержится гуанина-8%, аденина-32%, урацила-20%?

10. Фрагмент зрелой и-РНК инсулина имеет следующий состав:

УУУГУУГАУЦААЦАЦУУАУГУГГГУЦАЦАЦ. Определите длину фрагмента ДНК, если экзоны составляют 20% всех нуклеотидов гена.

Раздел 2. Задачи по теме «Свойства генетического кода»

Для решения этих задач необходимо знание свойств кода ДНК, умение пользоваться таблицей генетического кода.

Примеры решения задач

Задача 1. В белке содержится 51 аминокислота. Сколько нуклеотидов будет в цепи гена, кодирующей этот белок, и сколько — в соответствующем фрагменте молекулы ДНК?

Поскольку генетический код триплетен, т. е. одна аминокислота кодируется тремя нуклеотидами, то количество нуклеотидов в кодирующей цепи гена будет 51 × 3 = 153, а в двухцепочечной ДНК количество нуклеотидов будет вдвое больше, т. е. 153 × 2 = 306.

Ответ: в кодирующей цепи гена будет содержаться 153 нуклеотида, во фрагменте ДНК-306.

Задача 2. В кодирующей цепи гена содержится 600 нуклеотидов. Сколько аминокислот содержится в молекуле белка, информация о которой закодирована в этом гене, если в конце гена имеются два стоп — триплета?

1. Поскольку в конце гена имеются два стоп — кодона, то 6 нуклеотидов (2×3) не несут информации о структуре белка. Значит, информация о данном белке закодирована в цепочке из 594 (600 – 6) нуклеотидов.

Читайте так же:  Л карнитин повер систем

2. Основываясь на триплетности кода, подсчитаем количество аминокислот: 594 : 3 = 198.

Ответ: в молекуле белка содержится 198 аминокислот.

Задача 3. В белке содержится 25 аминокислот. Сколько нуклеотидов содержится в кодирующей цепи гена, если три «знака препинания» стоят в конце гена?

1.Определим количество нуклеотидов в кодирующей части соответствующей цепи гена: 25×3=75.

2. Поскольку каждый “знак препинания” содержит 3 нуклеотида, то общее количество нуклеотидов в кодирующей цепи гена составляет 75+3 × 3=84.

Ответ: в кодирующей цепи гена содержится 84 нуклеотида.

Задача 4. Длина фрагмента молекулы ДНК бактерии равняется 20,4 нм. Сколько аминокислот будет в белке, кодируемом данным фрагментом ДНК?

1. Определим число нуклеотидов в кодирующей цепи гена: 20,4 нм : 0,34 нм = 60.

2. Исходя из триплетности кода определяем количество аминокислот в белке: 60 :3 = 20.

Ответ: в белке будет 20 аминокислот.

Задача 5. Длина гена 34,68 нм. Какова масса молекулы белка, кодируемой данным геном, если по одному регуляторному триплету находится в начале и в

конце гена, длина одного нуклеотида — 0,34 нм, а масса одной аминокислоты — 100 а. е.?

1. Находим количество нуклеотидов в кодирующей цепи гена: 34,68 нм: 0,34 нм = 102.

2. Учитывая, что по одному регуляторному триплету находится в начале и в конце кодирующей цепи гена, находим количество нуклеотидов, несущих информацию о структуре белка: 102 – 2 × 3 = 96.

3. Зная, что за каждую аминокислоту отвечает один триплет нуклеотидов, определяем количество аминокислот

в молекуле белка: 96 : 3 = 32.

4. Находим массу белковой молекулы: 100 а. е.× 32=3200 а.е.

Ответ: масса белковой молекулы 3200 а. е.

Задачи для самостоятельного решения

1. Сколько аминокислот содержится в белке, если во фрагменте молекулы ДНК, в которой зашифрована информация об этом белке, содержится 100 адениловых и 200 гуаниловых нуклеотидов?

2. Сколько кодонов содержит участок кодирующей цепи ДНК со следующей последовательностью нуклеотидов: ААТГГЦЦАТГЦТТАТЦГГАГЦЦЦА? Сколько аминокислот будет в белке, кодируемом этим фрагментом гена?

3. Пользуясь таблицей генетического кода, определите, какие аминокислоты кодируются триплетами ЦАТ, ТТТ, ГАТ. Какими триплетами в ДНК закодированы аминокислоты валин, фенилаланин, триптофан?

4. Участок молекулы белка включает следующие аминокислоты: -лей-вал-лиз-алан-. Какова масса участка

одной цепи гена, кодирующей данный белок, если масса одного нуклеотида равна 350?

5. Относительная молекулярная масса белка равна 40 000, масса одного нуклеотида — 350, длина одного нуклеотида 0,34 нм, масса одной аминокислоты 100. Определить массу цепи гена, кодирующей этот белок.

6. Считая, что средняя относительная молекулярная масса аминокислоты около 110, а нуклеотида — 300, определите, что тяжелее — белок или кодирующий его ген? Во сколько раз?

7. В ДНК содержится информация о 150 аминокислотах, тимидиловых нуклеотидов в ней в 1,5 раза больше, чем гуаниловых. Определить, сколько нуклеотидов (по отдельности) содержится в ДНК и какова её длина.

8. Известно, что фрагмент кодирующей цепи гена бактерии содержит 30% гуаниловых, 25% адениловых, 45% цитидиловых нуклеотидов, а его длина составляет 122,4нм. Определить, сколько аминокислот будет содержаться во фрагменте молекулы белка, кодируемого этим геном? Сколько нуклеотидов каждого вида содержится на участке ДНК, в котором расположен данный ген?

9. Фрагмент ДНК собаки содержит 600 тимидиловых нуклеотидов. Определить количество аминокислот в белковой молекуле, если экзоны составляют 10% всех нуклеотидов кодирующей цепи гена,

а количество гуаниловых нуклеотидов в этом фрагменте ДНК равняется 35%.

10. Фрагмент кодирующей цепи гена мыши содержит 1800 нуклеотидов. Из них 600 приходятся на интроны. Кодирующая часть (экзоны) данного фрагмента

гена содержат 300 адениловых, 200 тимидиловых, 100 гуаниловых нуклеотидов. Определите:

1) длину данного фрагмента ДНК;

2) количество кодонов в зрелой и-РНК;

3) процентное содержание нуклеотидов каждого вида в зрелой и-РНК;

4) количество аминокислот в соответствующем фрагменте молекулы белка.

Раздел 3. Задачи по теме «Биосинтез белка»

Для решения этого типа задач необходимы знания о механизме биосинтеза белка (транскрипции, трансляции), принципе комплементарности, свойствах генетического кода, умение пользоваться таблицей генетического кода.

Примеры решения задач

Задача 1. Участок ДНК содержит последовательно расположенные нуклеотиды ААГТГТГАЦТТА. Укажите аминокислотный состав белковой цепи, кодируемой этим участком ДНК.

1. Распределяем участок ДНК на триплеты: ААГ ТГТ ГАЦ ТТА.

2. Используя таблицу генетического кода, переводим эти триплеты ДНК на язык аминокислот (этот этап работы можно проводить, «синтезируя» сначала и- РНК по цепи ДНК, а затем по ней — молекулу белка):

УУЦ АЦА ЦУГ ААУ

фен – тре – лей — асп

Ответ: аминокислотный состав белковой цепи будет следующий: фен-тре-лей-асп.

Задача 2. В молекуле белка следующая последовательность аминокислот: тре-лей-тир-лиз-сер-гли. Постройте участок и-РНК, на котором закодирован этот белок.

Используя таблицу генетического кода, находим кодоны и-РНК данных аминокислот и, выбирая любой из них, «синтезируем» молекулу и-РНК:

тре – лей – тир – лиз – сер – гли,

Ответ: структура и-РНК будет следующая: АЦУЦУУУАУАААУЦУГГУ.

Задача 3. Начальная часть молекулы белка имеет следующую структуру: цис — фен — тир. Какие т-РНК (с какими антикодонами) могут участвовать в синтезе этого белка?

Видео удалено.
Видео (кликните для воспроизведения).

Зная, что антикодоны т-РНК комплементарны кодонам и-РНК, по таблице генетического кода находим все возможные триплеты, кодирующие данные аминокислоты:

Источники


  1. Росенко Обществознание. Учебное пособие для поступающих в ВУЗы физической культуры / Росенко, др. М. и. — М.: СПб: Северная звезда, 2010. — 208 c.

  2. Е.М. Алексеев Основы учета и калькуляции в предприятиях общественного питания / Е.М. Алексеев, Н.М. Мифтахудинова. — М.: Экономика, 2008. — 128 c.

  3. Ланькова, Т.В. Врачевание питанием, здоровье и долголетие / Т.В. Ланькова, В.В. Ланьков. — М.: АСТ, 1999. — 400 c.
  4. Смагин, Алексей Здоровое питание без холестерина / Алексей Смагин , Ирина Смагина. — М.: Эксмо, 2006. — 256 c.
Сколькими нуклеотидами кодируется аминокислота
Оценка 5 проголосовавших: 1

ОСТАВЬТЕ ОТВЕТ

Please enter your comment!
Please enter your name here