Таблица аминокислот и рнк

Сегодня предлагаем ознакомится со статьей на тему: таблица аминокислот и рнк с профессиональным описанием и объяснением.

Генетический код – соответствие между триплетами ДНК и аминокислотами белков

Необходимость кодирования структуры белков в линейной последовательности нуклеотидов мРНК и ДНК продиктована тем, что в ходе трансляции:

  • нет соответствия между числом мономеров в матрице мРНК и продукте — синтезируемом белке;
  • отсутствует структурное сходство между мономерами РНК и белка.

Это исключает комплементарное взаимодействие между матрицей и продуктом — принцип, по которому осуществляется построение новых молекул ДНК и РНК в ходе репликации и транскрипции. Отсюда становится ясным, что должен существовать «словарь», позволяющий выяснить, какая последовательность нуклеотидов мРНК обеспечивает включение в белок аминокислот в заданной последовательности. Этот «словарь» получил название генетического, биологического, нуклеотидного, или аминокислотного кода. Он позволяет шифровать аминокислоты, входящие в состав белков, с помощью определённой последовательности нуклеотидов в ДНК и мРНК. Для него характерны определённые свойства.

[2]

Триплетность.Одним из основных вопросов при выяснении свойств кода был вопрос о числе нуклеотидов, которое должно определять включение в белок одной аминокислоты. Было установлено, что кодирующими элементами в шифровании аминокислотной последовательности действительно являются тройки нуклеотидов, или триплеты,которые получили название «кодоны».

Смысл кодонов. Удалось установить, что из 64 кодонов включение аминокислот в синтезирующуюся полипептидную цепь шифрует 61 триплет, а 3 остальных — UAA, UAG, UGA не кодируют включение в белок аминокислот и первоначально были названы бессмысленными, или нон-сенс-кодонами. Однако в дальнейшем было показано, что эти триплеты сигнализируют о завершении трансляции, и поэтому их стали называть терминирующими, или стоп-кодонами.

Кодоны мРНК и триплеты нуклеотидов в кодирующей нити ДНК с направлением от 5′ к 3′-концу имеют одинаковую последовательность азотистых оснований, за исключением того, что в ДНК вместо урацила (U), характерного для мРНК, стоит тимин (Т).

Специфичность. Каждому кодону соответствует только одна определённая аминокислота. В этом смысле генетический код строго однозначен.

Таблица 4-3. Основные компоненты белоксинтезирующей системы

Необходимые компоненты Функции
1 . Аминокислоты Субстраты для синтеза белков
2. тРНК тРНК выполняют функцию адаптеров. Они акцепторным концом взаимодействуют с аминокислотами, а антикодоном — с кодоном мРНК.
3. Аминоацил-тРНК синтетазы Каждая аа-тРНК-синтетаза катализирует реакцию специфического связывания одной из 20 аминокислот с соответствующей тРНК
4.мРНК Матрица содержит линейную последовательность кодонов, определяющих первичную структуру белков
5. Рибосомы Рибонуклеопротеиновые субклеточные структуры, являющиеся местом синтеза белков
6. АТФ, ГТФ Источники энергии
7. Белковые факторы инициации, элонгации, терминации Специфические внерибосомные белки, необходимые для процесса трансляции (12 факторов инициации: elF; 2 фактора элонгации: eEFl, eEF2, и факторы терминации: eRF)
8. Ионы магния Кофактор, стабилизирующий структуру рибосом

Примечания:elF (eukaryotic initiation factors) — факторы инициации; eEF (eukaryotic elongation factors) — факторы элонгации; eRF (eukaryotic releasing factors) — факторы терминации.

Вырожденность. В мРНК и ДНК имеет смысл 61 триплет, каждый из которых кодирует включение в белок одной из 20 аминокислот. Из этого следует, что в информационных молекулах включение в белок одной и той же аминокислоты определяют несколько кодонов. Это свойство биологического кода получило название вырожденности.

У человека одним кодоном зашифрованы только 2 аминокислоты — Мет и Три, тогда как Лей, Сер и Apr — шестью кодонами, а Ала, Вал, Гли, Про, Тре — четырьмя кодонами (табл. 4-4).

Избыточность кодирующих последовательностей — ценнейшее свойство кода, так как она повышает устойчивость информационного потока к неблагоприятным воздействиям внешней и внутренней среды. При определении природы аминокислоты, которая должна быть включена в белок, третий нуклеотид в кодоне не имеет столь важного значения, как первые два. Как видно из табл. 4-4, для многих аминокислот замена нуклеотида в третьей позиции кодона не сказывается на его смысле.

Линейность записи информации. В ходе трансляции кодоны мРНК «читаются» с фиксированной стартовой точки последовательно и не перекрываются. В записи информации отсутствуют сигналы, указывающие на конец одного кодона и начало следующего. Кодон AUG является инициирующим и прочитывается как в начале, так и в других участках мРНК как Мет. Следующие за ним триплеты читаются последовательно без каких-либо пропусков вплоть до стоп-кодона, на котором синтез полипептидной цепи завершается.

Универсальность. До недавнего времени считалось, что код абсолютно универсален, т.е. смысл кодовых слов одинаков для всех изученных организмов: вирусов, бактерий, растений, земноводных, млекопитающих, включая человека. Однако позднее стало известно одно исключение, оказалось, что митохондриальная мРНК содержит 4 триплета, имеющих другое значение, чем в мРНК ядерного происхождения. Так, в мРНК митохондрий триплет UGA кодирует Три, AUA — Мет, а АСА и AGG прочитываются как дополнительные стоп-кодоны.

Колинеарность гена и продукта. У прокариотов обнаружено линейное соответствие последовательности кодонов гена и последовательности аминокислот в белковом продукте, или, как говорят, существует колинеарность гена и продукта.

[3]

Таблица 4-4. Генетический код

Первое основание Второе основание
U С А G
U UUU Фен UCU Cep UAU Тир UGU Цис
UUС Фен UCC Сер иАСТир UGC Цис
UUА Лей UCA Cep UAA * UGA *
UUG Лей UCG Сер UAG * UGG Apr
С CUU Лей CCU Про CAU Гис CGU Apr
CUC Лей ССС Про САС Гис CGC Apr
CUA Лей ССА Про САА Глн CGA Apr
CUG Лей CCG Про CAG Глн CGG Apr
А AUU Иле ACU Tpe AAU Асн AGU Сер
AUC Иле АСС Тре ААС Асн AGG Сер
AUA Мет АСА Тре ААА Лиз AGA Apr
AUG Мет ACG Тре AAG Лиз AGG Apr
G GUU Ban GCU Ала GAU Асп GGU Гли
GUC Вал GCC Ала GAC Асп GGC Гли
GUА Вал GСА Ала GАА Глу GGA Гли
GUG Вал GСG Ала GAG Глу GGG Гли
Читайте так же:  Глютамин как правильно принимать в капсулах

Примечания:U — урацил; С — цитозин; А — аденин; G — гуанин; * — терминирующий кодон.

У эукариотов последовательности оснований в гене, колинеарные аминокислотной последовательности в белке, прерываются нитронами. Поэтому в эукариотических клетках аминокислотная последовательность белка колинеарна последовательности экзонов в гене или зрелой мРНК после посттранскригщионного удаления интронов.

Таблица аминокислот и рнк

Синтез белка — один из основных процессов метаболизма в клетке. Это — матричный синтез. Для синтеза белка необходимы ДНК, иРНК, тРНК, рРНК (рибосомы), аминокислоты, ферменты, ионы магния, энергия АТФ. Основная роль в определении структуры белка принадлежит ДНК.

Информация об аминокислотной последовательности в молекуле белка закодирована в молекуле ДНК. Способ записи информации называют кодированием. Генетический код — это система записи информации о последовательности расположения аминокислот в белках с помощью последовательности расположения нуклеотидов в информационной РНК.

В состав РНК входят нуклеотиды 4 типов: А, Г, Ц, У. В состав белковых молекул входит 20 аминокислот. Каждая из 20 аминокислот зашифрована последовательностью 3 нуклеотидов, называемых триплетом, или кодоном. Из 4 нуклеотидов можно создать 64 различные комбинации по 3 нуклеотида в каждой (4 3 =64).

Свойства генетического кода

1. Генетический код триплетный:

Триплеты нуклеотидов Аминокислоты
  • УЦУ
  • ГЦУ
  • ГУЦ
  • серин
  • аланин
  • валин

2. Код вырожден. Это означает, что каждая аминокислота кодируется более чем одним кодоном (от 2 до 6):

Триплеты нуклеотидов Аминокислоты
  • УУГ
  • УУА
  • ЦУУ
  • ЦУЦ
> Лейцин

3. Код не перекрывающийся. Это значит, что последовательно расположенные кодоны являются последовательно расположенными триплетами нуклеотидов:

кодоны УУЦ УЦУ УУГ
аминокислоты фенилаланин серин лейцин

4. Универсален для всех клеток (человека, животных, растений).

5. Специфичен. Один и тот же триплет не может соответствовать нескольким аминокислотам.

6. Синтез белка начинается со стартового (начального) кодона АУГ, который кодирует аминокислоту метионин.

7. Заканчивается синтез белка одним из трех стоп-кодонов, не кодирующих аминокислоты: УАГ, УАА, УГА.

Аминокислота Кодоны иРНК
  • Фенилаланин
  • Лейцин
  • Изолейцин
  • Метионин
  • Валин
  • Серин
  • Пролин
  • Треонин
  • Аланин
  • Тирозин
  • Гистидин
  • Глицин
  • Аспарагин
  • Лизин
  • Аспарагиновая кислота
  • Глутамин
  • Цистеин
  • Триптофан
  • Аргининовая кислота
  • Аргинин
  • УУГ, УУЦ
  • УУА, УУГ, ЦУУ, ЦУЦ
  • УЦА, ЦУГ, АУУ, УАЦ, АУА
  • АУГ
  • ГУУ, ГУЦ, ГУА, ГУГ
  • УЦУ, УЦЦ, УЦА, УЦГ
  • ЦЦУ, ЦЦЦ, ЦЦА, ЦЦГ
  • АЦУ, АЦЦ, АЦА, АЦГ
  • ГЦУ, ГЦЦ, ГЦА, ГЦГ
  • УАУ, УАЦ
  • ЦАУ, ЦАЦ
  • ЦАА, ЦАГ
  • ААУ, ААЦ
  • ААА, ААГ
  • ГАУ, ГАЦ
  • ГАА, ГАГ
  • УГУ, УГЦ
  • УГГ
  • ЦГУ, ЦГЦ, ЦГА, ЦГГ
  • АГА, АГГ

Участок ДНК, содержащий информацию о структуре определенного белка, называют геном. Ген непосредственного участия в синтезе белка не принимает. Посредником между геном и белком является информационная РНК (иРНК). ДНК играет роль матрицы для синтеза иРНК в ядре клетки. Молекула ДНК на участке гена раскручивается. С одной из ее цепей переписывается информация на иРНК в соответствии с принципом комплементарности между азотистыми основаниями нуклеиновых кислот. Этот процесс называют транскрипцией. Транскрипция происходит в ядре клетки при участии фермента РНК-полимеразы и с использованием энергии АТФ (рис. 37).

Синтез белка осуществляется в цитоплазме на рибосомах, где иРНК служит матрицей (рис. 38). Перевод последовательности триплетов нуклеотидов в молекуле иРНК в специфическую последовательность аминокислот называют трансляцией. Синтезированная иРНК выходит через поры в ядерной оболочке в цитоплазму клетки, объединяется с рибосомами, образуя полирибосомы (полисомы). Каждая рибосома состоит из двух субъединиц — большой и малой. иРНК присоединяется к малой субъединице в присутствии ионов магния (рис. 39).

В цитоплазме находятся транспортные РНК (тРНК). Каждая аминокислота имеет свою тРНК. У молекулы тРНК на одной из петель имеется триплет нуклеотидов (антикодон), который комплементарен триплету нуклеотидов на иРНК (кодону).

Аминокислоты, находящиеся в цитоплазме, активируются (взаимодействуют с АТФ) и с помощью фермента аминоацил-тРНК-синтетазы присоединяются к тРНК. Первый (стартовый) кодон иРНК — АУГ — несет информацию об аминокислоте метионине (рис. 40). К этому кодону подходит молекула тРНК, содержащая комплементарный антикодон и несущая первую аминокислоту метионин. Это обеспечивает соединение большой и малой субъединиц рибосомы. Второй кодон иРНК присоединяет тРНК, содержащую антикодон, комплементарный этому кодону. тРНК содержит вторую аминокислоту. Между первой и второй аминокислотами образуется пептидная связь. Рибосома прерывисто, триплет за триплетом, перемещается по иРНК. Первая тРНК освобождается и выходит в цитоплазму, где может соединяться со своей аминокислотой.

По мере продвижения рибосомы по иРНК к полипептидной цепочке присоединяются аминокислоты, соответствующие триплетам иРНК и привезенные тРНК (рис. 41).

«Считывание» рибосомой информации, заключенной в иРНК, происходит до тех пор, пока не дойдет до одного из трех стоп-кодонов (УАА, УГА, УАГ). Полипептидная цепь

выходит из рибосомы и приобретает структуру, свойственную данному белку.

Читайте так же:  Сколько нуклеотидов кодируют последовательность 60 аминокислот

Непосредственная функция отдельного гена состоит в кодировании структуры определенного белка-фермента, который катализирует одну биохимическую реакцию, протекающую в определенных условиях среды.

Ген (участок ДНК) → иРНК → белок-фермент → биохимическая реакция → наследственный признак.

Вопросы для самоконтроля

  1. Где в клетке происходит синтез белка?
  2. Где записана информация о синтезе белка?
  3. Какие свойства имеет генетический код?
  4. С какого кодона начинается синтез белка?
  5. Какими кодонами заканчивается синтез белка?
  6. Что такое ген?
  7. Как и где происходит транскрипция?
  8. Как называют триплеты нуклеотидов в молекуле иРНК?
  9. Что такое трансляция?
  10. Каким образом к тРНК присоединяется аминокислота?
  11. Как называют триплет нуклеотидов в молекуле тРНК?
  12. Какая аминокислота обеспечивает соединение большой и малой субъединиц рибосомы?
  13. Как происходит образование полипептидной цепочки белка?

Ключевые слова темы «Синтез белка»

  • азотистые основания
  • аланин
  • аминокислоты
  • антикодон
  • белок
  • биохимическая реакция
  • валин
  • ген
  • генетический код
  • действие
  • ДНК
  • запись
  • информация
  • ионы магния
  • иРНК
  • кодирование
  • кодон
  • лейцин
  • матрица
  • метаболизм
  • метионин
  • наследственный признак
  • нуклеиновые кислоты
  • пептидная связь
  • петля
  • полирибосома
  • поры
  • последовательность
  • посредник
  • принцип комплементарности
  • рибосомы
  • рРНК
  • серин
  • синтез
  • сочетание
  • способ
  • структура
  • субъединица
  • транскрипция
  • трансляция
  • триплет
  • тРНК
  • участок
  • фенилаланин
  • ферменты
  • цепочка
  • цитоплазма
  • энергия АТФ
  • ядро

Таблица аминокислот и рнк

Первый пример отклонения от стандартного генетического кода был открыт в 1979 году при исследовании генов митохондрий человека. С того времени было найдено несколько подобных вариантов [3] , включая многообразные альтернативные митохондриальные коды, [4] например, прочитывание стоп-кодона УГА в качестве кодона, определяющего триптофан у микоплазм. У бактерий и архей ГУГ и УУГ часто используются как стартовые кодоны. В некоторых случаях гены начинают кодировать белок со старт-кодона, который отличается от обычно используемого данным видом [3] .

В некоторых белках нестандартные аминокислоты, такие как селеноцистеин и пирролизин, вставляются рибосомой, прочитывающей стоп-кодон, что зависит от последовательностей в мРНК. Селеноцистеин сейчас рассматривается в качестве 21-й, а пирролизин 22-й аминокислот, входящих в состав белков.

Несмотря на эти исключения, у всех живых организмов генетический код имеет общие черты: кодон состоят из трёх нуклеотидов, где два первых являются определяющими, кодоны транслируются тРНК и рибосомами в последовательность аминокислот.

Отклонения от стандартного генетического кода [3] [5] .
Пример Кодон Обычное значение Читается как:
Некоторые виды дрожжей рода Candida CUG Лейцин Серин
Митохондрии, в частности у Saccharomyces cerevisiae CU(U, C, A, G) Лейцин Серин
Митохондрии высших растений CGG Аргинин Триптофан
Митохондрии (у всех без исключения исследованных организмов) UGA Стоп Триптофан
Митохондирии млекопитающих, дрозофилы, S. cerevisiae и многих простейших AUA Изолейцин Метионин = Старт
Прокариоты GUG Валин Старт
Эукариоты (редко) CUG Лейцин Старт
Эукариоты (редко) GUG Валин Старт
Прокариоты (редко) UUG Лейцин Старт
Эукариоты (редко) ACG Треонин Старт
Митохондрии млекопитающих AGC, AGU Серин Стоп
Митохондрии дрозофилы AGA Аргинин Стоп
Митохондрии млекопитающих AG(A, G) Аргинин Стоп

История представлений о генетическом коде

Знания о белках и нуклеиновых кислотах накапливались в течение длительного времени. К середине XX века их стало достаточно для того, чтобы выдвинуть первые идеи о природе генетического кода. К 1953 году было известно, что отдельные белки имеют уникальные аминокислотные последовательности и что, по-видимому, не существует никаких ограничений на порядок аминокислот в полипептиде [6] . Имелись данные о том, что белки состоят примерно из 20—23 различных аминокислот, однако списки различались у разных авторов. В генетике была сформирована концепция «один ген — один фермент» (более точно «один ген — один полипептид»), также было установлено, что гены это ДНК, а не белки [7] .

В 1953 году Уотсон и Крик опубликовали две работы: в первой говорилось о вторичной структуре ДНК [8] , а во второй — о возможном механизме копирования ДНК путём матричного синтеза [9] . В последней работе, они указали на то, что определённая последовательность оснований является кодом, который несёт генетическую информацию. Теперь предстояло решить вопрос о том, как эта последовательность оснований определяет последовательность аминокислот в белках.

Хотя некоторые предположения о механизме кодирования высказывались и раньше [10] , первым кто предложил абстрактную гипотезу кодирования, а также способ её проверки, был советский и американский физик-теоретик Георгий (Джордж) Гамов. В 1954 году Гамов опубликовал свою работу, в которой предложил в качестве механизма кодирования установление соответствия между боковыми цепями аминокислот и ромбовидными «дырами», образованными четырьмя нуклеотидами ДНК [11] . Позднее этот код был назван ромбическим или бубновым. Исходя из своей модели Гамов предположил, что код может быть триплетным. Несмотря на все очевидные недочёты этой гипотезы (например, идея о том, что структура белка напрямую кодируется ДНК) она стала первой среди многих более и менее абстрактных гипотез о природе кода. Гамов был первым, кто представил проблему кодирования не как биохимическую, а просто как задачу перевода их четырёхзначной системы в двадцатизначную.

Тем не менее в начале 60-х годов XX века новые данные обнаружили несостоятельность гипотезы «кода без запятых». Тогда эксперименты показали, что кодоны, считавшиеся Криком бессмысленными, могут провоцировать белковый синтез в пробирке, и к 1965 году был установлен смысл всех 64 триплетов. Оказалось, что некоторые кодоны просто-напросто избыточны, то есть целый ряд аминокислот кодируется двумя, четырьмя или даже шестью триплетами.

Таблица аминокислот и рнк

Известно, что все виды РНК син­те­зи­ру­ют­ся на ДНК-матрице. Фраг­мент цепи тРНК имеет сле­ду­ю­щую по­сле­до­ва­тель­ность нуклеотидов: УГА-ГГА-ЦУЦ-ГЦА-УУГ-АУЦ.

Уста­но­ви­те фраг­мент мо­ле­ку­лы ДНК, на ко­то­рой син­те­зи­ру­ет­ся дан­ная тРНК, аминокислоту, ко­то­рую при­но­сит эта тРНК к рибосомам, если её тре­тий три­плет яв­ля­ет­ся антикодоном;

Читайте так же:  Жиросжигатели для похудения женщин

иРНК, пе­ре­но­ся­щую ин­фор­ма­цию и по­сле­до­ва­тель­ность ами­но­кис­лот в мо­ле­ку­ле белка, ко­то­рый ко­ди­ру­ет­ся дан­ной мо­ле­ку­лой ДНК.

Правила поль­зо­ва­ния таблицей

Первый нук­лео­тид в три­пле­те берётся из ле­во­го вер­ти­каль­но­го ряда, вто­рой — из верх­не­го го­ри­зон­таль­но­го ряда и тре­тий — из пра­во­го вер­ти­каль­но­го ряда. Там, где пе­ре­се­кут­ся линии, иду­щие от всех трёх нуклеотидов, и на­хо­дит­ся ис­ко­мая аминокислота.

Элементы пра­виль­но­го ответа

1) ДНК — АЦТ ЦЦТ ГАГ ЦГТ ААЦ ТАГ

2) тРНК УГА-ГГА-ЦУЦ-ГЦА-УУГ-АУЦ.

[1]

3) иРНК АЦУ-ЦЦУ-ГАГ-ЦГУ-ААЦ-УАГ

4) Кодон иРНК — ГАГ , ами­но­кис­ло­та — ГЛУ

5) Последовательность ами­но­кис­лот в мо­ле­ку­ле белка: тре-про-глу-арг-асн-…

Примечание от составителей сайта.

Ответы (3 и 5) данного задания ошибочны, поэтому задание отправляется «в невыдачи». Если такое задание попадется в ГИА — подавайте на апелляцию.

В задании просят найти:

Уста­но­ви­те фраг­мент мо­ле­ку­лы ДНК, на ко­то­рой син­те­зи­ру­ет­ся дан­ная тРНК,

аминокислоту, ко­то­рую при­но­сит эта тРНК к рибосомам, если её тре­тий три­плет яв­ля­ет­ся антикодоном;

иРНК, пе­ре­но­ся­щую ин­фор­ма­цию и по­сле­до­ва­тель­ность ами­но­кис­лот в мо­ле­ку­ле белка, ко­то­рый ко­ди­ру­ет­ся дан­ной мо­ле­ку­лой ДНК.

Элементы пра­виль­но­го ответа:

1) По принципу комплементарности на основе тРНК находим фраг­мент мо­ле­ку­лы ДНК, на ко­то­рой син­те­зи­ру­ет­ся дан­ная тРНК

2) По принципу комплементарности на основе тре­тьего три­плета тРНК, который яв­ля­ет­ся антикодоном,находим триплет иРНК

3) по таблице генетического кода находим аминокислоту, которую переносит данная тРНК: глу

Следующий ниже элемент задания не имеет биологического смысла, т.к. один и тот же участок ДНК не может служить матрицей и для иРНК и для тРНК

4) По принципу комплементарности на основе ДНК (которую мы установили в пункте 1) находим фраг­мент мо­ле­ку­лы иРНК

5) На основе иРНК по таблице генетического кода находим последовательность аминокислот

белок: — -гли-лей- ала -лей- иле

Видео (кликните для воспроизведения).

(данный белок начинается со стоп-кодона, что указывает на ошибку)

Тест по теме генетический код:
Ребята хэлп
Задача 1.
Даны аминокислоты: аргинин, триптофан, тирозин, гистидин, фенилаланин. Найдите код этих аминокислот в ДНК.
Задача 2:
В молекуле белка следующая последовательность аминокислот: треонин, пролин, лизин, глутамин. Запишите, какой будет код этих аминокислот в ДНК.

Задача №1
—————

Дана цепь аминокислот :

аргинин — триптофан — тирозин — гистидин — фенилаланин

По таблице генетического кода ( см.приложение) строим цепь и-РНК:

ЦГУ — УГГ — УАУ — ЦАУ — УУУ

Из цепочки и-РНК по принципу комплементарности А=Т ; Г=Ц строим цепь ДНК ( внимание: эта цепь ДНК, которую мы строим, является второй цепочкой ДНК. ):

ГЦА — АЦЦ — АТА — ГТА — ААА = вторая цепь ДНК

Теперь строим первую цепь ДНК по принципу комплементарности А=Т ; Г=Ц:

ЦГТ — ТГГ — ТАТ — ЦАТ — ТТТ = первая цепь ДНК.

Задача №2
—————-

Дана цепь аминокислот:

треонин — пролин — лизин — глутамин

По таблице генетического кода (см.приложение) строим цепь и-РНК:

АЦУ — ЦЦГ — ААА — ГАА

Из цепочки и-РНК по принципу комплементарности А=Т ; Г=Ц строим цепь ДНК ( внимание: эта цепь ДНК, которую мы строим, является второй цепочкой ДНК. ):

ТГА — ГГЦ — ТТТ — ЦТТ — вторая цепь ДНК

Теперь строим первую цепь ДНК по принципу комплементарности А=Т ; Г=Ц:

АЦТ — ЦЦГ — ААА — ГАА — первая цепь ДНК

Определяем последовательность аминокислот с помощью таблицы генетического кода.

2) После мутации фрагмент молекулы белка будет иметь состав лей- ала- тре -лиз -асн

3) Лизин кодируется двумя кодонами ААА и ААГ, следовательно,

мутированная иРНК: ЦУЦ-ГЦА-АЦГ-ААА-ААУ или ЦУЦ-ГЦА-АЦГ-ААГ-ААУ

13)Одна из цепей ДНК имеет последовательность нуклеотидов: АТА-АГГ-АТГ-ЦЦТ-ТТТ. Определите последовательность нуклеотидов на иРНК и соответствующую последовательность аминокислот фрагмента молекулы белка. Объясните, что произойдет со структурой фрагмента молекулы белка, если второй триплет нуклеотидов выпадет из цепи ДНК. Для выполнения задания используйте таблицу генетического кода. (см. задание №1)

Ответ:1)Исходная цепь ДНК: АТА -АГГ- АТГ-ЦЦТ-ТТТ

2) и -РНК : УАУ- УЦЦ-УАЦ-ГГА- ААА

3) цепочка аминокислот в белке: тир – сер – тир – гли — лиз

4) после выпадения второго триплета произойдет укорочение молекулы белка на одну аминокислоту и молекула белка будет состоять из аминокислот: тир – тир – гли – Лиз

14)Последовательность нуклеотидов в цепи ДНК: — ААТГЦАГГТЦАЦТЦАТГ- В результате мутации одновременно выпадают второй и пятый нуклеотиды. Запишите новую последовательность нуклеотидов в цепи ДНК. Определите по ней последовательность нуклеотидов в иРНК и последовательность аминокислот в полипептиде. Для выполнения задания используйте таблицу генетического кода.

Ответ:1)Исходная цепь ДНК: ААТ-ГЦА-ГГТ-ЦАЦ-ТЦА-ТГ-

ДНК после мутации: АТГ- АГГ-ТЦА-ЦТЦ-АТГ-

2) и -РНК : УАЦ-УЦЦ-АЦУ- ГАГ- УАЦ

3) цепочка аминокислот в белке: тир – сер – тре – глу – тир

15)Фрагмент молекулы и-РНК состоит из 51 нуклеотидов. Определите число нуклеотидов в двойной цепи ДНК, число триплетов в матричной цепи ДНК и число нуклеотидов в антикодонах всех т-РНК, которые участвуют в синтезе белка. Ответ поясните.

Ответ: 1) И-РНК синтезируется на матричной цепи ДНК, поэтому в ней будет тоже 51 нуклеотид, т.е. 17 триплетов (1 триплет состоит из 3-х нуклеотидов). 2) Вторая цепь ДНК комплементарна первой, поэтому число нуклеотидов в двойной цепи ДНК содержится 102 нуклеотида. 3) Если в и-РНК содержится 51 нуклеотид, значит, в ней 17 кодонов, и столько же антикодонов в т-РНК. Число нуклеотидов в антикодонах всех т-РНК будет равно 51, так как антикодон тоже состоит из 3-х нуклеотидов.

Читайте так же:  Аминокислоты организма заменимые и незаменимые

16) Фрагмент молекулы и-РНК состоит из 50 нуклеотидов. Определите, сколько нуклеотидов входит в состав фрагмента матричной цепи ДНК. Установите, число цитозиновых, адениловых и гуаниловых нуклеотидов в молекуле ДНК , если известно, что процент тимидиловых нуклеотидов равен 16%

Ответ: 1) В составе матричной цепи ДНК 50 нуклеотидов, так как и-РНК синтезируется комплементарно матричной цепи 2) Так как в одной цепи ДНК 50 нуклеотидов, в двух цепях- 100нуклеотидов (это и есть 100%). 3) В ДНК тимин комплементарен аденину, поэтому количество аденина равно 16. На гуанин и цитозин приходится 68% (100- 32=68) в равных количествах, т.е. гуанина и цитозина в ДНК содержится по 34.

Не нашли то, что искали? Воспользуйтесь поиском:

Лучшие изречения: Студент — человек, постоянно откладывающий неизбежность. 10218 —

| 7236 — или читать все.

Таблица генетического кода днк

Таблица генетического кода днк

В таблице показан генетический код матричной рибонуклеиновой кислоты (мРНК), то есть он показывает все 64 возможные комбинации кодонов, состоящих из трех нуклеотидов (три-нуклеотидных единиц), которые определяют аминокислоты белка при сборке.

Каждый кодон дезоксирибонуклеиновой кислоты (ДНК) кодирует и определяет одну аминокислоту, и каждый нуклеотидный блок состоит из фосфата, сахара и дезоксирибозы одного из 4 азотистых нуклеотидных оснований: аденин (А), гуанин (G), цитозин (C ) и тимин (Т). Основания являются парными и соединены друг с другом водородными связями в двойной спирали ДНК. мРНК соответствует ДНК (т.е. последовательность нуклеотидов та же в обоих цепях) за исключением того, что в РНК, тимин (Т) заменяется на урацил (U), и дезоксирибоза заменяется на рибозу.

Процесс перевода генетической информации в сборке белка требует участия первой мРНК, которая считывается 5 ‘к 3’ (точно так, как ДНК), а затем передает рибонуклеиновую кислоту (тРНК), которая считывается 3 ‘к 5’.тРНК.

Таблица генетического кода днк показывает, что есть 64 различные возможные комбинации нуклеотидов с триплетными кодонами. Тем не менее, не все 64 кодона генетического кода указывают на одну аминокислоту в процессе перевода. Причина в том, что в организме человека 20 аминокислот (кроме селеноцистеина) участвуют в переводе. Таким образом, одна аминокислота может кодироваться более чем одним кодоном мРНК-триплета.

Таблица аминокислот и рнк

Небольшой экскурс в историю кодов можно прочитать здесь: Общие свойства кодов

СВОЙСТВА ГЕНЕТИЧЕСКОГО КОДА

Проектное задание с кубиками и

поздравление с праздником.

Для «перевода» с языка азотистых оснований нуклеиновых кислот (ДНК и РНК) на язык белков (последовательность аминокислот в полипептидной цепи) можно воспользоваться Таблицей генетического кода или онлайновой машиной-переводчиком ( EMBOSS Transeq ), созданной в Европейском институте биоинформатитки (European Bioinformatics Institute). Протеиновая машина расположена по адресу http://www.ebi.ac.uk/Tools/st/emboss_transeq/. На рисунке ниже представлена рабочая часть машины-переводчика.

Под названием вы видите ссылку на таблицу генетического кода, список для выбора типа кода (по умолчанию — Standard, об этом списке см. ниже) и поле для ввода последовательности нуклеотидов ДНК (Enter or Paste a nucleic acid Sequence). Перевод осуществляется нажатием на расположенную ниже кнопку Run.

При этом программа переходит на новую страницу, на которой представлены условия выбора и результаты ее работы — создана последовательность аминокислот полипептида, закодированная введенной вами иР НК.
При этом указывается, из скольких звеньев состояла иР НК, сколько аминокислот в полипептидной цепочке, что это за аминокислоты ( RDLCCVX — последовательность Аргинин — Аспарагиновая кислота — Лейцин — Цистеин — Цистеин — Валин, см. условные обозначения).
Выбор в стартовом окне в списке Colour позволяет (на новой странице с отчетом) увидеть полипептидную цепь, в которой отдельные аминокислоты имеют разный цвет в зависимости от их свойств. Выбор в списке Reverse позволяет определить аминокислотную последовательность не по иРНК (или по комплементарной нити ДНК) , а по смысловой нити ДНК. В списке Region определяется, с какого нуклеотида надо начинать считывание информации (с первого в триплете или с другого).

1. Триплетность — каждая аминокислота кодируется тремя нуклеотидами. Три нуклеотида, являющиеся единицей кода, называются триплетом, или кодоном.
Генетический код не может быть одинарным, т.к. нуклеотидов ДНК всего 4, а аминокислот — 20.
Кодировать аминокислоты двумя нуклеотидами каждую также недостаточно, т.к. возможно только 4 2 = 16 вариантов. Следующий логически вариант — кодировать аминокислоту тремя нуклеотидами, т.к. возможно 4 3 = 64 варианта.

Откройте страницу EMBOSS Transeq, скопируйте через буфер обмена приведенную ниже последовательность нуклеотидов в окно Enter or Paste a nucleic acid Sequence
auguccagagcauacccguauucu
или наберите в нем свою последовательность, и переведите приведенную последовательность в белок, нажав кнопку кнопку Run.

2. Триплеты не отграничены друг от друга, но есть сочетания нуклеотидов, обозначающих «точку», конец считывания — «стоп-кодоны» .

Переведите с помощью EMBOSS Transeq приведенную ниже последовательность в белок. Обратите внимание, что фрагмент состоит из 24 мономеров. Сколько аминокислот в пептиде? Вывод — что обозначает * ?
auguacccguauuccagagcauag

Откройте таблицу генетического кода и найдите в ней стоп-кодоны. Какие сочетания нуклеотидов их кодируют?

3. Вырожденность — одна аминокислота может кодироваться несколькими разными триплетами.
Вырожденность является следствием триплетности кода, т.к. четыре нуклеотида, взятые по 3, могут закодировать 4 3 = 64 разных объекта, тогда как аминокислот всего 20 . Убедимся на примере.

Читайте так же:  Л аргинин действие на организм

Ниже приведены две последовательности нуклеотидов, различающиеся между собой по 11 позициям из 18. Переведите с помощью EMBOSS Transeq обе последовательности в белки. Сколько аминокислотных различий между ними?
1) augucuagauuaggcuca 2) augagccggcucggaagu

4. Универсальность — генетический код одинаков для всех живых организмов на Земле, т.е. в клетке любого из существ одинаковая последовательность нуклеотидов будет кодировать ту же аминокислоту (см. рис. слева внизу).
Впрочем, правильнее утверждать, что генетический код практически универсален, т.к. в некоторых генетических системах (например, в генах митохондрий и хлоропластов) есть некоторые отличия от стандартного кода, присущего организмам.

Переведите с помощью EMBOSS Transeq приведенную ниже последовательность в белок, используя основной (Standard) вариант кода. Запишите полученный белок.
uacagacccauaugcgguacuuga

Вернитесь к стартовой странице EMBOSS Transeq и откройте список (красная стрелка на рисунке ниже), а в нем выберите второй вариант кода — Vertebrate Mitochondrial (2).

Снова введите в окно для ДНК ту же последовательность нуклеотидов (или воспользуйтесь уже введенной, если вернулись на страницу с помощью «Назад» браузера). Запишите полученный белок и сравните с полученным ранее.
Поэкспериментируйте с кодами других генетических систем.

Как Вы думаете, какое значение для организмов имеет то, что генетический код клеток и митохондрий различен? Каковы причины этого?

Перевод одного и того же фрагмента разными кодами позволяет решить несколько олимпиадных задач:

1. Полную последовательность нуклеотидов и-РНК со всеми кодонам перевести каждым из кодов и построить филогенетическое древо кодов по полученным аминокислотным последовательностям (и положению стоп-кодонов). В результате может получиться, например, такое древо (спасибо Statistica for Windows ) .
2. Показав различия между кодами разных генетических систем, постарайтесь найти подтверждения теории, по которой исторически более ранним был вариант кода с двумя значимыми нуклеотидами и третьим-разделителем.

5. Неперекрываемость : каждый участок ДНК хранит информацию не более чем об одном белке. Иными словами, если участок ДНК кодирует белок, то не может кодировать (начиная с какого-нибудь другого нуклеотида) другой белок.

Переведите с помощью EMBOSS Transeq приведенную ниже последовательность в белок. Запишите полученный белок. А теперь попробуйте удалить первые два нуклеотида и получить другой пептид, представив, что генетический перекрывается. Запишите полученный пептид и сравните с первым.
uaugcuaagauuccuuucgga

Правильнее утверждать, что генетический код практически неперекрываемый, т.к. у вирусов, у которых большое количество информации должно поместиться в небольшом фрагменте, наблюдается двойное, а у фага f Х 147 — даже тройное перекрывание (небольшой участок входит одновременно в 3 разных гена).

Что имеет большую массу — белок или кодирующий его структурный ген? Решите задачу: 1) для глюкагона, состоящего из 29 аминокислотных остатков; 2) в общем виде — для белка из N аминокислотных остатков (вспомни, какое свойство генетического кода лежит в основе задачи).

Теперь, когда ты стал опытным дешифровщиком, попробуй решить обратную задачу: по молекуле белка восстановить состав (точнее, один из возможных вариантов — вспомни, какое свойство генетического кода делает ответ неоднозначным)
Аминокислоты : Метионин — Аргинин — Лизин — Валин — Триптофан — (стоп-кодон)
Видимо, стОит воспользоваться таблицей генетического кода.

M S R L GS

M S * L GS

Обратитесь к текстовой иллюстрации свойств кода и точковых мутаций (пример взят из «Основ современной генетики» С.М. Гершензона + пример на английском языке из Hocking S. OCR A2 Biology Student Book) — файл Иллюстрация свойств кода. Придумайте собственную фразу из трехбуквенных слов, которая бы иллюстрировала все свойства генетического кода); перекрываемость генетического кода у вирусов; различия в общем и митохондриальном кодах. Как это можно проиллюстрировать?

Проектное задание
На рисунке слева — кубики аминокислот с кодонами. Это неплохое проектное задание для 10-классников: сделать такой конструктор для учеников 9 класса, знакомящихся с биосинтезом белка впервые (только сделать всё по уму, с антикодонами т-РНК). Заодно предложите подумать над таким вопросом:
Чтение и ферменты

В описании биосинтеза белка лингвистические аналогии достаточно распространены. Транскрипция знакома по изучению английского: запись произношения того же слова на том же языке, но чуть иными символами и с иной целью. Трансляция и вовсе «перевод»: с языка нуклеотидов на язык аминокислот. Это, так сказать, эпический зачин.
Обслуживают все процессы биосинтеза белка различные ферменты: РНК-полимеразы, аминоацил-т-РНК-синтетазы, ДНК-гиразы и т.д., и т.п. Вопрос: какой (какие) из этих ферментов умеют читать , т.е. понимают смысл того текста, который переводят?
Можно не спешить с ответом, а подождать до темы о регуляции генной активности.
См. также кодо-додекаэдр.

Закодированное поздравление
Видео (кликните для воспроизведения).

Приведенная ниже последовательность является поздравлением с праздником. Перекодируйте с языка оснований ДНК на язык аминокислот, чтобы узнать, с каким:

Источники


  1. Кузнецов, Василий Степанович Практикум по теории и методике физической культуры и спорта. Учебное пособие для студентов учреждений высшего образования / Кузнецов Василий Степанович. — М.: Академия (Academia), 2014. — 134 c.

  2. Исаева, Е.Л. Антицеллюлитная гимнастика. Ровная гладкая кожа за 1 месяц / Е.Л. Исаева. — М.: Книга по Требованию, 2008. — 200 c.

  3. Бранд, Я. Б. Здоровое питание / Я.Б. Бранд. — М.: Октопус, 2006. — 240 c.
Таблица аминокислот и рнк
Оценка 5 проголосовавших: 1

ОСТАВЬТЕ ОТВЕТ

Please enter your comment!
Please enter your name here