Таблица аминокислот и триплетов

Сегодня предлагаем ознакомится со статьей на тему: таблица аминокислот и триплетов с профессиональным описанием и объяснением.

Таблица аминокислот и триплетов

Небольшой экскурс в историю кодов можно прочитать здесь: Общие свойства кодов

СВОЙСТВА ГЕНЕТИЧЕСКОГО КОДА

Проектное задание с кубиками и

поздравление с праздником.

Для «перевода» с языка азотистых оснований нуклеиновых кислот (ДНК и РНК) на язык белков (последовательность аминокислот в полипептидной цепи) можно воспользоваться Таблицей генетического кода или онлайновой машиной-переводчиком ( EMBOSS Transeq ), созданной в Европейском институте биоинформатитки (European Bioinformatics Institute). Протеиновая машина расположена по адресу http://www.ebi.ac.uk/Tools/st/emboss_transeq/. На рисунке ниже представлена рабочая часть машины-переводчика.

Под названием вы видите ссылку на таблицу генетического кода, список для выбора типа кода (по умолчанию — Standard, об этом списке см. ниже) и поле для ввода последовательности нуклеотидов ДНК (Enter or Paste a nucleic acid Sequence). Перевод осуществляется нажатием на расположенную ниже кнопку Run.

При этом программа переходит на новую страницу, на которой представлены условия выбора и результаты ее работы — создана последовательность аминокислот полипептида, закодированная введенной вами иР НК.
При этом указывается, из скольких звеньев состояла иР НК, сколько аминокислот в полипептидной цепочке, что это за аминокислоты ( RDLCCVX — последовательность Аргинин — Аспарагиновая кислота — Лейцин — Цистеин — Цистеин — Валин, см. условные обозначения).
Выбор в стартовом окне в списке Colour позволяет (на новой странице с отчетом) увидеть полипептидную цепь, в которой отдельные аминокислоты имеют разный цвет в зависимости от их свойств. Выбор в списке Reverse позволяет определить аминокислотную последовательность не по иРНК (или по комплементарной нити ДНК) , а по смысловой нити ДНК. В списке Region определяется, с какого нуклеотида надо начинать считывание информации (с первого в триплете или с другого).

1. Триплетность — каждая аминокислота кодируется тремя нуклеотидами. Три нуклеотида, являющиеся единицей кода, называются триплетом, или кодоном.
Генетический код не может быть одинарным, т.к. нуклеотидов ДНК всего 4, а аминокислот — 20.
Кодировать аминокислоты двумя нуклеотидами каждую также недостаточно, т.к. возможно только 4 2 = 16 вариантов. Следующий логически вариант — кодировать аминокислоту тремя нуклеотидами, т.к. возможно 4 3 = 64 варианта.

Откройте страницу EMBOSS Transeq, скопируйте через буфер обмена приведенную ниже последовательность нуклеотидов в окно Enter or Paste a nucleic acid Sequence
auguccagagcauacccguauucu
или наберите в нем свою последовательность, и переведите приведенную последовательность в белок, нажав кнопку кнопку Run.

2. Триплеты не отграничены друг от друга, но есть сочетания нуклеотидов, обозначающих «точку», конец считывания — «стоп-кодоны» .

Переведите с помощью EMBOSS Transeq приведенную ниже последовательность в белок. Обратите внимание, что фрагмент состоит из 24 мономеров. Сколько аминокислот в пептиде? Вывод — что обозначает * ?
auguacccguauuccagagcauag

Откройте таблицу генетического кода и найдите в ней стоп-кодоны. Какие сочетания нуклеотидов их кодируют?

3. Вырожденность — одна аминокислота может кодироваться несколькими разными триплетами.
Вырожденность является следствием триплетности кода, т.к. четыре нуклеотида, взятые по 3, могут закодировать 4 3 = 64 разных объекта, тогда как аминокислот всего 20 . Убедимся на примере.

Ниже приведены две последовательности нуклеотидов, различающиеся между собой по 11 позициям из 18. Переведите с помощью EMBOSS Transeq обе последовательности в белки. Сколько аминокислотных различий между ними?
1) augucuagauuaggcuca 2) augagccggcucggaagu

4. Универсальность — генетический код одинаков для всех живых организмов на Земле, т.е. в клетке любого из существ одинаковая последовательность нуклеотидов будет кодировать ту же аминокислоту (см. рис. слева внизу).
Впрочем, правильнее утверждать, что генетический код практически универсален, т.к. в некоторых генетических системах (например, в генах митохондрий и хлоропластов) есть некоторые отличия от стандартного кода, присущего организмам.

Переведите с помощью EMBOSS Transeq приведенную ниже последовательность в белок, используя основной (Standard) вариант кода. Запишите полученный белок.
uacagacccauaugcgguacuuga

Вернитесь к стартовой странице EMBOSS Transeq и откройте список (красная стрелка на рисунке ниже), а в нем выберите второй вариант кода — Vertebrate Mitochondrial (2).

Снова введите в окно для ДНК ту же последовательность нуклеотидов (или воспользуйтесь уже введенной, если вернулись на страницу с помощью «Назад» браузера). Запишите полученный белок и сравните с полученным ранее.
Поэкспериментируйте с кодами других генетических систем.

Как Вы думаете, какое значение для организмов имеет то, что генетический код клеток и митохондрий различен? Каковы причины этого?

Перевод одного и того же фрагмента разными кодами позволяет решить несколько олимпиадных задач:

1. Полную последовательность нуклеотидов и-РНК со всеми кодонам перевести каждым из кодов и построить филогенетическое древо кодов по полученным аминокислотным последовательностям (и положению стоп-кодонов). В результате может получиться, например, такое древо (спасибо Statistica for Windows ) .
2. Показав различия между кодами разных генетических систем, постарайтесь найти подтверждения теории, по которой исторически более ранним был вариант кода с двумя значимыми нуклеотидами и третьим-разделителем.

5. Неперекрываемость : каждый участок ДНК хранит информацию не более чем об одном белке. Иными словами, если участок ДНК кодирует белок, то не может кодировать (начиная с какого-нибудь другого нуклеотида) другой белок.

Переведите с помощью EMBOSS Transeq приведенную ниже последовательность в белок. Запишите полученный белок. А теперь попробуйте удалить первые два нуклеотида и получить другой пептид, представив, что генетический перекрывается. Запишите полученный пептид и сравните с первым.
uaugcuaagauuccuuucgga

Правильнее утверждать, что генетический код практически неперекрываемый, т.к. у вирусов, у которых большое количество информации должно поместиться в небольшом фрагменте, наблюдается двойное, а у фага f Х 147 — даже тройное перекрывание (небольшой участок входит одновременно в 3 разных гена).

Что имеет большую массу — белок или кодирующий его структурный ген? Решите задачу: 1) для глюкагона, состоящего из 29 аминокислотных остатков; 2) в общем виде — для белка из N аминокислотных остатков (вспомни, какое свойство генетического кода лежит в основе задачи).

Теперь, когда ты стал опытным дешифровщиком, попробуй решить обратную задачу: по молекуле белка восстановить состав (точнее, один из возможных вариантов — вспомни, какое свойство генетического кода делает ответ неоднозначным)
Аминокислоты : Метионин — Аргинин — Лизин — Валин — Триптофан — (стоп-кодон)
Видимо, стОит воспользоваться таблицей генетического кода.

M S R L GS

[3]

M S * L GS

Читайте так же:  Л карнитин будь здоров

Обратитесь к текстовой иллюстрации свойств кода и точковых мутаций (пример взят из «Основ современной генетики» С.М. Гершензона + пример на английском языке из Hocking S. OCR A2 Biology Student Book) — файл Иллюстрация свойств кода. Придумайте собственную фразу из трехбуквенных слов, которая бы иллюстрировала все свойства генетического кода); перекрываемость генетического кода у вирусов; различия в общем и митохондриальном кодах. Как это можно проиллюстрировать?

Проектное задание
На рисунке слева — кубики аминокислот с кодонами. Это неплохое проектное задание для 10-классников: сделать такой конструктор для учеников 9 класса, знакомящихся с биосинтезом белка впервые (только сделать всё по уму, с антикодонами т-РНК). Заодно предложите подумать над таким вопросом:
Чтение и ферменты

В описании биосинтеза белка лингвистические аналогии достаточно распространены. Транскрипция знакома по изучению английского: запись произношения того же слова на том же языке, но чуть иными символами и с иной целью. Трансляция и вовсе «перевод»: с языка нуклеотидов на язык аминокислот. Это, так сказать, эпический зачин.
Обслуживают все процессы биосинтеза белка различные ферменты: РНК-полимеразы, аминоацил-т-РНК-синтетазы, ДНК-гиразы и т.д., и т.п. Вопрос: какой (какие) из этих ферментов умеют читать , т.е. понимают смысл того текста, который переводят?
Можно не спешить с ответом, а подождать до темы о регуляции генной активности.
См. также кодо-додекаэдр.

Закодированное поздравление

Приведенная ниже последовательность является поздравлением с праздником. Перекодируйте с языка оснований ДНК на язык аминокислот, чтобы узнать, с каким:

Таблица аминокислот и триплетов

Смотреть что такое «ГЕНЕТИЧЕСКИЙ КОД» в других словарях:

ГЕНЕТИЧЕСКИЙ КОД — ГЕНЕТИЧЕСКИЙ КОД, система записи наследственной информации в виде последовательности нуклеотидов в молекулах нуклеиновых кислот. Единицей генетического кода служит кодон, или триплет (тринуклеотид). Генетический код определяет порядок включения… … Современная энциклопедия

генетический код — Долгое время наследственные механизмы были предметом внимания генетиков, но природа молекул, переносящих информацию от одного индивида к другому, оставалась неведомой. Была известна роль макромолекул протеина и нуклеиновых кислот в этом… … Западная философия от истоков до наших дней

Генетический код — ГЕНЕТИЧЕСКИЙ КОД, система записи наследственной информации в виде последовательности нуклеотидов в молекулах нуклеиновых кислот. Единицей генетического кода служит кодон, или триплет (тринуклеотид). Генетический код определяет порядок включения… … Иллюстрированный энциклопедический словарь

ГЕНЕТИЧЕСКИЙ КОД — см. Код генетический … Большой Энциклопедический словарь

ГЕНЕТИЧЕСКИЙ КОД — ГЕНЕТИЧЕСКИЙ КОД, системная информация, накопленная в ГЕНАХ. Точно устанавливает, каким образом в организме вырабатывается весь сложный комплекс веществ, находящихся в живой клетке, а также способ воспроизведения самой клетки. Это начальная… … Научно-технический энциклопедический словарь

ГЕНЕТИЧЕСКИЙ КОД — Нуклеотидная последовательность клеточной ДНК, в которой закодирована последовательность аминокислот белка. Генетический код ДНК четырехбуквенный. Каждой аминокислоте соответствует один (или несколько) определенный кодон ДНК. В кодон входят три и … Термины и определения, используемые в селекции, генетике и воспроизводстве сельскохозяйственных животных

Генетический код — КОД, а, м. Система условных обозначений, сигналов, передающих информацию. Телеграфный к. ифровой к. Толковый словарь Ожегова. С.И. Ожегов, Н.Ю. Шведова. 1949 1992 … Толковый словарь Ожегова

генетический код — – способ кодирования в нуклеиновых кислотах информации о первичной структуре белков … Краткий словарь биохимических терминов

генетический код — Единая система записи наследственной информации в виде последовательности нуклеотидов [http://www.dunwoodypress.com/148/PDF/Biotech Eng Rus.pdf] Тематики биотехнологии EN genetic code … Справочник технического переводчика

Генетический код — Генетический код свойственный всем живым организмам способ кодирования аминокислотной последовательности белков при помощи последовательности нуклеотидов. В ДНК используется четыре азотистых основания аденин (А), гуанин (G), цитозин… … Википедия

Таблица аминокислот и триплетов

Генетический код и его свойства

«Самым трудным в проблеме кода было понять, что код существует. На это потребовалось целое столетие.
Когда это поняли, то для того чтобы разобраться в деталях, хватило каких-нибудь десяти лет.»

Ичас М. Биологический код. М.: Мир, 1971

Нуклеотиды ДНК и РНК
  1. Пуриновые: аденин, гуанин
  2. Пиримидиновые: цитозин, тимин (урацил)
таб. 1. Аминокислоты, которые обычно встречаются в белках Название Сокращенное обозначение 1. Аланин Ala 2. Аргинин Arg 3. Аспарагин Asn 4. Аспарагиновая кислота Asp 5. Цистеин Cys 6. Глутаминовая кислота Glu 7. Глутамин Gln 8. Глицин Gly 9. Гистидин His 10. Изолейцин Ile 11. Лейцин Leu 12. Лизин Lys 13. Метионин Met 14. Фенилаланин Phe 15. Пролин Pro 16. Серии Ser 17. Треонин Thr 18. Триптофан Trp 19. Тирозин Tyr 20. Валин Val

Генетический код, который еще называют аминокислотным кодом, — это система записи информации о последовательности расположения аминокислот в белке с помощью последовательности расположения нуклеотидных остатков в ДНК, которые содержат одно из 4-х азотистых оснований: аденин (А), гуанин (G), цитозин (C) и тимин (Т). Однако, поскольку двунитчатая спираль ДНК не принимает непосредственного участия в синтезе белка, который кодируется одной из этих нитей (т.е. РНК), то код записывается на языке РНК, в котором вместо тимина входит урацил (U). По этой же причине принято говорить, что код — это последовательность нуклеотидов, а не пар нуклеотидов.

Генетический код представлен определенными кодовыми словами, — кодонами.

Первое кодовое слово было расшифровано Ниренбергом и Маттеи в 1961 г. Они получили из кишечной палочки экстракт, содержащий рибосомы и прочие факторы, необходимые для синтеза белка. Получилась бесклеточная система для синтеза белка, которая могла бы осуществлять сборку белка из аминокислот, если в среду добавить необходимую мРНК. Добавив в среду синтетическую РНК, состоящую только из урацилов, они обнаружили, что образовался белок, состоящий только из фенилаланина (полифенилаланин). Так было установлено, что триплет нуклеотидов УУУ (кодон) соответствует фенилаланину. В течение последующих 5-6 лет были определены все кодоны генетического кода.

Генетический код — своеобразный словарь, переводящий текст, записанный с помощью четырех нуклеотидов, в белковый текст, записанный с помощью 20 аминокислот. Остальные аминокислоты, встречающиеся в белке, являются модификациями одной из 20 аминокислот.

Читайте так же:  Сколько аминокислот закодировано в днк

Свойства генетического кода

Генетический код имеет следующие свойства.

    Триплетность — каждой аминокислоте соответствует тройка нуклеотидов. Легко подсчитать, что существуют 4 3 = 64 кодона. Из них 61 является смысловым и 3 — бессмысленными (терминирующими, stop-кодонами).

Непрерывность (нет разделительных знаков между нуклеотидами) — отсутствие внутригенных знаков препинания;

Внутри гена каждый нуклеотид входит в состав значащего кодона. В 1961г. Сеймур Бензер и Френсис Крик экспериментально доказали триплетность кода и его непрерывность (компактость) [показать]

Суть эксперимента: «+» мутация — вставка одного нуклеотида. «-» мутация — выпадение одного нуклеотида.

Одиночная мутация («+» или «-«) в начале гена или двойная мутация («+» или «-«) — портит весь ген.

Тройная мутация («+» или «-«) в начале гена портит лишь часть гена.

Четверная «+» или «-» мутация опять портит весь ген.

Эксперимент был проведен на двух рядом расположенных фаговых генах и показал, что

  1. код триплетен и внутри гена нет знаков препинания
  2. между генами есть знаки препинания

Наличие межгенных знаков препинания — наличие среди триплетов инициирующих кодонов (с них начинается биосинтез белка), кодонов — терминаторов (обозначают конец биосинтеза белка);

Условно к знакам препинания относится и кодон AUG — первый после лидерной последовательности. Он выполняет функцию заглавной буквы. В этой позиции он кодирует формилметионин (у прокариот).

В конце каждого гена, кодирующего полипептид, находится, по меньшей мере, один из 3-х терминирующих кодонов, или стоп-сигналов: UAA, UAG, UGA. Они терминируют трансляцию.

Колинеарность — соответствие линейной последовательности кодонов мРНК и аминокислот в белке.

Специфичность — каждой аминокислоте соответствуют только определенные кодоны, которые не могут использоваться для другой аминокислоты.

Однонаправленность — кодоны считываются в одном направлении — от первого нуклеотида к последующим

Вырожденность, или избыточность,- одну аминокислоту может кодировать несколько триплетов (аминокислот – 20, возможных триплетов – 64, 61 из них смысловой, т. е. в среднем каждой аминокислоте соответствует около 3 кодонов); исключение составляет метионин (Met) и триптофан (Trp).

Причина вырожденности кода состоит в том, что главную смысловую нагрузку несут два первых нуклеотида в триплете, а третий не так важен. Отсюда правило вырожденности кода: если два кодона имеют два одинаковых первых нуклеотида, а их третьи нуклеотиды принадлежат к одному классу (пуриновому или пиримидиновому), то они кодируют одну и ту же аминокислоту.

Однако из этого идеального правила есть два исключения. Это кодон АUА, который должен соответствовать не изолейцину, а метионину и кодон UGА, который является терминирующим, тогда как должен соответствовать триптофану. Вырожденность кода имеет, очевидно, приспособительное значение.

Универсальность — все перечисленные выше свойства генетического кода характерны для всех живых организмов.

Кодон Универсальный код Митохондриальные коды
Позвоночные Беспозвоночные Дрожжи Растения
UGA STOP Trp Trp Trp STOP
AUA Ile Met Met Met Ile
CUA Leu Leu Leu Thr Leu
AGA Arg STOP Ser Arg Arg
AGG Arg STOP Ser Arg Arg

В последнее время принцип универсальности кода был поколеблен в связи c открытием Береллом в 1979 г. идеального кода митохондрий человека, в котором выполняется правило вырожденности кода. В коде митохондрий кодон UGA соответствует триптофану, а AUA — метионину, как того требует правило вырожденности кода.

Возможно, в начале эволюции у всех простейших организмов был такой же код, как и у митохондрий, а затем он претерпел небольшие отклонения.

Неперекрываемость — каждый из триплетов генетического текста независим друг от друга, один нуклеотид входит в состав только одного триплета; На рис. показана разница между перекрывающимся и неперекрывающимся кодом.

В 1976г. была секвенирована ДНК фага φХ174. У него одноцепочечная кольцевая ДНК, состоящая из 5375 нуклеотидов. Было известно, что фаг кодирует 9 белков. Для 6 из них были определены гены, располагающиеся друг за другом.

Выяснилось, что есть перекрывание. Ген Е полностью находится внутри гена D. Его инициирующий кодон появляется в результате сдвига считывания на один нуклеотид. Ген J начинается там, где кончается ген D. Инициирующий кодон гена J перекрывается с терминирующим кодоном гена D в результате сдвига на два нуклеотида. Конструкция называется «сдвиг рамки считывания» на число нуклеотидов, некратное трем. На сегодняшний день перекрывание показано только для нескольких фагов.

Помехоустойчивость — отношение числа консервативных замен к числу радикальных замен.

Мутации замен нуклеотидов, не приводящие к смене класса кодируемой аминокислоты, называют консервативными. Мутации замен нуклеотидов, приводящие к смене класса кодируемой аминокислоты, называют радикальными.

Так как одна и та же аминокислота может кодироваться разными триплетами, то некоторые замены в триплетах не приводят к замене кодируемой аминокислоты (например UUU -> UUC оставляет фенилаланин). Некоторые замены меняют аминокислоту на другую из того же класса (неполярный, полярный, основной, кислотный), остальные замены меняют и класс аминокислоты.

В каждом триплете можно провести 9 однократных замен, т.е. выбрать, какую из позиций меняем — можно тремя способами (1-я или 2-я или 3-я), причем выбранную букву (нуклеотид) можно поменять на 4-1=3 других буквы (нуклеотида). Общее количество возможных замен нуклеотидов — 61 по 9 = 549.

Прямым подсчетом по таблице генетического кода можно убедиться, что из них: 23 замены нуклеотидов приводят к появлению кодонов — терминаторов трансляции. 134 замены не меняют кодируемую аминокислоту. 230 замен не меняют класс кодируемой аминокислоты. 162 замены приводят к смене класса аминокислоты, т.е. являются радикальными. Из 183 замен 3-его нуклеотида, 7 приводят к появлению терминаторов трансляции, а 176 — консервативны. Из 183 замен 1-ого нуклеотида, 9 приводят к появлению терминаторов, 114 — консервативны и 60 — радикальны. Из 183 замен 2-го нуклеотида, 7 приводят к появлению терминаторов, 74 — консервативны, 102 — радикальны.

Таблица аминокислот и триплетов

UUU (Phe/F)Фенилаланин
UUC (Phe/F)Фенилаланин
UUA (Leu/L)Лейцин
UUG (Leu/L)Лейцин

UCU (Ser/S)Серин
UCC (Ser/S)Серин
UCA (Ser/S)Серин
UCG (Ser/S)Серин

UAU (Tyr/Y)Тирозин
UAC (Tyr/Y)Тирозин
UAA Ochre (Стоп)
UAG Amber (Стоп)

CUU (Leu/L)Лейцин
CUC (Leu/L)Лейцин
CUA (Leu/L)Лейцин
CUG (Leu/L)Лейцин

CCU (Pro/P)Пролин
CCC (Pro/P)Пролин
CCA (Pro/P)Пролин
CCG (Pro/P)Пролин

CAU (His/H)Гистидин
CAC (His/H)Гистидин
CAA (Gln/Q)Глутамин
CAG (Gln/Q)Глутамин

CGU (Arg/R)Аргинин
CGC (Arg/R)Аргинин
CGA (Arg/R)Аргинин
CGG (Arg/R)Аргинин

AUU (Ile/I)Изолейцин
AUC (Ile/I)Изолейцин
AUA (Ile/I)Изолейцин
AUG (Met/M)Метионин, Start [2]

Читайте так же:  Л карнитин в организме

ACU (Thr/T)Треонин
ACC (Thr/T)Треонин
ACA (Thr/T)Треонин
ACG (Thr/T)Треонин

AAU (Asn/N)Аспарагин
AAC (Asn/N)Аспарагин
AAA (Lys/K)Лизин
AAG (Lys/K)Лизин

AGU (Ser/S)Серин
AGC (Ser/S)Серин
AGA (Arg/R)Аргинин
AGG (Arg/R)Аргинин

GUU (Val/V)Валин
GUC (Val/V)Валин
GUA (Val/V)Валин
GUG (Val/V)Валин

GCU (Ala/A)Аланин
GCC (Ala/A)Аланин
GCA (Ala/A)Аланин
GCG (Ala/A)Аланин

GAU (Asp/D)Аспарагиновая кислота
GAC (Asp/D)Аспарагиновая кислота
GAA (Glu/E)Глутаминовая кислота
GAG (Glu/E)Глутаминовая кислота

GGU (Gly/G)Глицин
GGC (Gly/G)Глицин
GGA (Gly/G)Глицин
GGG (Gly/G)Глицин

Обратная таблица (указаны кодоны для каждой аминокислоты, а также стоп-кодоны)
Ala/A GCU, GCC, GCA, GCG Leu/L UUA, UUG, CUU, CUC, CUA, CUG
Arg/R CGU, CGC, CGA, CGG, AGA, AGG Lys/K AAA, AAG
Asn/N AAU, AAC Met/M AUG
Asp/D GAU, GAC Phe/F UUU, UUC
Cys/C UGU, UGC Pro/P CCU, CCC, CCA, CCG
Gln/Q CAA, CAG Ser/S UCU, UCC, UCA, UCG, AGU, AGC
Glu/E GAA, GAG Thr/T ACU, ACC, ACA, ACG
Gly/G GGU, GGC, GGA, GGG Trp/W UGG
His/H CAU, CAC Tyr/Y UAU, UAC
Ile/I AUU, AUC, AUA Val/V GUU, GUC, GUA, GUG
START AUG STOP UAG, UGA, UAA

Вариации стандартного генетического кода

Первый пример отклонения от стандартного генетического кода был открыт в 1979 году при исследовании генов митохондрий человека. С того времени было найдено несколько подобных вариантов [3] включая многообразные альтернативные митохондриальные коды, [4] , например, прочитывание стоп-кодона УГА в качестве кодона, определяющего триптофан у микоплазм. У бактерий и архей ГУГ и УУГ часто используются как стартовые кодоны. В некоторых случаях гены начинают кодировать белок со старт-кодона, который отличается от обычно используемого данным видом [5] .

Видео удалено.
Видео (кликните для воспроизведения).

В некоторых белках нестандартные аминокислоты, такие как селеноцистеин и пирролизин вставляются рибосомой, прочитывающей стоп-кодон, что зависит от последовательностей в иРНК. Селеноцистеин сейчас рассматривается в качестве 21-й, а пирролизин 22-й аминокислот, входящих в состав белков.

Несмотря на эти исключения, у всех живых организмов генетический код имеет общие черты: кодон состоят из трёх нуклеотидов, где два первых являются определяющими, кодоны транслируются тРНК и рибосомами в последовательность аминокислот.

Таблица аминокислот и триплетов

Синтез белка — один из основных процессов метаболизма в клетке. Это — матричный синтез. Для синтеза белка необходимы ДНК, иРНК, тРНК, рРНК (рибосомы), аминокислоты, ферменты, ионы магния, энергия АТФ. Основная роль в определении структуры белка принадлежит ДНК.

Информация об аминокислотной последовательности в молекуле белка закодирована в молекуле ДНК. Способ записи информации называют кодированием. Генетический код — это система записи информации о последовательности расположения аминокислот в белках с помощью последовательности расположения нуклеотидов в информационной РНК.

В состав РНК входят нуклеотиды 4 типов: А, Г, Ц, У. В состав белковых молекул входит 20 аминокислот. Каждая из 20 аминокислот зашифрована последовательностью 3 нуклеотидов, называемых триплетом, или кодоном. Из 4 нуклеотидов можно создать 64 различные комбинации по 3 нуклеотида в каждой (4 3 =64).

Свойства генетического кода

1. Генетический код триплетный:

Триплеты нуклеотидов Аминокислоты
  • УЦУ
  • ГЦУ
  • ГУЦ
  • серин
  • аланин
  • валин

2. Код вырожден. Это означает, что каждая аминокислота кодируется более чем одним кодоном (от 2 до 6):

Триплеты нуклеотидов Аминокислоты
  • УУГ
  • УУА
  • ЦУУ
  • ЦУЦ
> Лейцин

3. Код не перекрывающийся. Это значит, что последовательно расположенные кодоны являются последовательно расположенными триплетами нуклеотидов:

кодоны УУЦ УЦУ УУГ
аминокислоты фенилаланин серин лейцин

4. Универсален для всех клеток (человека, животных, растений).

5. Специфичен. Один и тот же триплет не может соответствовать нескольким аминокислотам.

6. Синтез белка начинается со стартового (начального) кодона АУГ, который кодирует аминокислоту метионин.

7. Заканчивается синтез белка одним из трех стоп-кодонов, не кодирующих аминокислоты: УАГ, УАА, УГА.

Аминокислота Кодоны иРНК
  • Фенилаланин
  • Лейцин
  • Изолейцин
  • Метионин
  • Валин
  • Серин
  • Пролин
  • Треонин
  • Аланин
  • Тирозин
  • Гистидин
  • Глицин
  • Аспарагин
  • Лизин
  • Аспарагиновая кислота
  • Глутамин
  • Цистеин
  • Триптофан
  • Аргининовая кислота
  • Аргинин
  • УУГ, УУЦ
  • УУА, УУГ, ЦУУ, ЦУЦ
  • УЦА, ЦУГ, АУУ, УАЦ, АУА
  • АУГ
  • ГУУ, ГУЦ, ГУА, ГУГ
  • УЦУ, УЦЦ, УЦА, УЦГ
  • ЦЦУ, ЦЦЦ, ЦЦА, ЦЦГ
  • АЦУ, АЦЦ, АЦА, АЦГ
  • ГЦУ, ГЦЦ, ГЦА, ГЦГ
  • УАУ, УАЦ
  • ЦАУ, ЦАЦ
  • ЦАА, ЦАГ
  • ААУ, ААЦ
  • ААА, ААГ
  • ГАУ, ГАЦ
  • ГАА, ГАГ
  • УГУ, УГЦ
  • УГГ
  • ЦГУ, ЦГЦ, ЦГА, ЦГГ
  • АГА, АГГ

Участок ДНК, содержащий информацию о структуре определенного белка, называют геном. Ген непосредственного участия в синтезе белка не принимает. Посредником между геном и белком является информационная РНК (иРНК). ДНК играет роль матрицы для синтеза иРНК в ядре клетки. Молекула ДНК на участке гена раскручивается. С одной из ее цепей переписывается информация на иРНК в соответствии с принципом комплементарности между азотистыми основаниями нуклеиновых кислот. Этот процесс называют транскрипцией. Транскрипция происходит в ядре клетки при участии фермента РНК-полимеразы и с использованием энергии АТФ (рис. 37).

Синтез белка осуществляется в цитоплазме на рибосомах, где иРНК служит матрицей (рис. 38). Перевод последовательности триплетов нуклеотидов в молекуле иРНК в специфическую последовательность аминокислот называют трансляцией. Синтезированная иРНК выходит через поры в ядерной оболочке в цитоплазму клетки, объединяется с рибосомами, образуя полирибосомы (полисомы). Каждая рибосома состоит из двух субъединиц — большой и малой. иРНК присоединяется к малой субъединице в присутствии ионов магния (рис. 39).

В цитоплазме находятся транспортные РНК (тРНК). Каждая аминокислота имеет свою тРНК. У молекулы тРНК на одной из петель имеется триплет нуклеотидов (антикодон), который комплементарен триплету нуклеотидов на иРНК (кодону).

Аминокислоты, находящиеся в цитоплазме, активируются (взаимодействуют с АТФ) и с помощью фермента аминоацил-тРНК-синтетазы присоединяются к тРНК. Первый (стартовый) кодон иРНК — АУГ — несет информацию об аминокислоте метионине (рис. 40). К этому кодону подходит молекула тРНК, содержащая комплементарный антикодон и несущая первую аминокислоту метионин. Это обеспечивает соединение большой и малой субъединиц рибосомы. Второй кодон иРНК присоединяет тРНК, содержащую антикодон, комплементарный этому кодону. тРНК содержит вторую аминокислоту. Между первой и второй аминокислотами образуется пептидная связь. Рибосома прерывисто, триплет за триплетом, перемещается по иРНК. Первая тРНК освобождается и выходит в цитоплазму, где может соединяться со своей аминокислотой.

По мере продвижения рибосомы по иРНК к полипептидной цепочке присоединяются аминокислоты, соответствующие триплетам иРНК и привезенные тРНК (рис. 41).

Читайте так же:  Анализ крови повышен креатин

«Считывание» рибосомой информации, заключенной в иРНК, происходит до тех пор, пока не дойдет до одного из трех стоп-кодонов (УАА, УГА, УАГ). Полипептидная цепь

выходит из рибосомы и приобретает структуру, свойственную данному белку.

Непосредственная функция отдельного гена состоит в кодировании структуры определенного белка-фермента, который катализирует одну биохимическую реакцию, протекающую в определенных условиях среды.

Ген (участок ДНК) → иРНК → белок-фермент → биохимическая реакция → наследственный признак.

Вопросы для самоконтроля

  1. Где в клетке происходит синтез белка?
  2. Где записана информация о синтезе белка?
  3. Какие свойства имеет генетический код?
  4. С какого кодона начинается синтез белка?
  5. Какими кодонами заканчивается синтез белка?
  6. Что такое ген?
  7. Как и где происходит транскрипция?
  8. Как называют триплеты нуклеотидов в молекуле иРНК?
  9. Что такое трансляция?
  10. Каким образом к тРНК присоединяется аминокислота?
  11. Как называют триплет нуклеотидов в молекуле тРНК?
  12. Какая аминокислота обеспечивает соединение большой и малой субъединиц рибосомы?
  13. Как происходит образование полипептидной цепочки белка?

Ключевые слова темы «Синтез белка»

  • азотистые основания
  • аланин
  • аминокислоты
  • антикодон
  • белок
  • биохимическая реакция
  • валин
  • ген
  • генетический код
  • действие
  • ДНК
  • запись
  • информация
  • ионы магния
  • иРНК
  • кодирование
  • кодон
  • лейцин
  • матрица
  • метаболизм
  • метионин
  • наследственный признак
  • нуклеиновые кислоты
  • пептидная связь
  • петля
  • полирибосома
  • поры
  • последовательность
  • посредник
  • принцип комплементарности
  • рибосомы
  • рРНК
  • серин
  • синтез
  • сочетание
  • способ
  • структура
  • субъединица
  • транскрипция
  • трансляция
  • триплет
  • тРНК
  • участок
  • фенилаланин
  • ферменты
  • цепочка
  • цитоплазма
  • энергия АТФ
  • ядро

Решение задач по общей и молекулярной генетике

Предлагаемый задачник включает задачи по следующим темам: молекулярная генетика (роль нуклеиновых кислот в пластическом обмене), наследование признаков при моногибридном скрещивании (I и II законы Менделя), наследование признаков при дигибридном скрещивании (III закон Менделя), наследование признаков сцепленных с полом. Задачи расположены по сложности, звездочками (*) отмечены задачи повышенной сложности.

Задачник содержит методические рекомендации, цель которых – помочь в самостоятельном освоении способов решения задач. В пособии приводятся примеры типовых задач с подробным объяснением оформления, условных обозначений и решения. Каждый тип задач предваряется кратким теоретическим материалом. Для закрепления полученных знаний предлагаются контрольные задания (Приложение 5), которые можно решать как в классе, так и дома (с последующим зачетом этой контрольной работы).

Пособие может быть использовано как при углубленном изучении биологии в школе, так и при подготовке к поступлению в вузы.

Решение задач по молекулярной генетике

Ген – это участок ДНК, кодирующий определенный белок. Малейшее изменение структуры ДНК ведет к изменениям белка, что в свою очередь изменяет цепь биохимических реакций с его участием, определяющих тот или иной признак или серию признаков.

Первичная структура белка, т.е. последовательность амнокислотных остатков, зашифрована в ДНК в виде последовательности азотистых оснований аденина (А), тимина (Т), гуанина (Г) и цитозина (Ц). Каждая аминокислота кодируется одной или несколькими последовательностями из трех нуклеотидов – триплетами. Синтезу белка предшествует перенос его кода с ДНК на информационную РНК (иРНК) – транскрипция. При транскрипции выполняется принцип дополнения, или комплементарности: А, Т, Г и Ц в ДНК соответствуют У (урацил), А, Ц и Г в иРНК. Непосредственно синтез белка, или трансляция, происходит на рибосоме: аминокислоты, подносимые к рибосоме своими транспортными РНК (тРНК), соединяются в полипептидную цепь белка соответственно триплетам оснований иРНК.

Однозначная связь между последовательностями нуклеотидов в ДНК и аминокислот в полипептидной цепи белка позволяет по одной из них определить другую. Зная изменения в ДНК, можно сказать, как изменится первичная структура белка.

Задача 1. Фрагмент молекулы ДНК состоит из нуклеотидов, расположенных в следующей последовательности: ТАААТГГЦААЦЦ. Определите состав и последовательность аминокислот в полипептидной цепи, закодированной в этом участке гена.

Выписываем нуклеотиды ДНК и, разбивая их на триплеты, получаем кодоны цепи молекулы ДНК:
ТАА–АТГ–ГЦА–АЦЦ.
Составляем триплеты иРНК, комплементарные кодонам ДНК, и записываем их строчкой ниже:
ДНК: ТАА–АТГ–ГЦА–АЦЦ
иРНК: АУУ–УАЦ–ЦГУ–УТТ.
По таблице кодонов (Приложение 6) определяем, какая аминокислота закодирована каждым триплетом иРНК:
Иле–Тир–Арг–Трп.

Задача 2. Фрагмент молекулы содержит аминокислоты: аспарагиновая кислота–аланин–метионин–валин. Определите:

а) какова структура участка молекулы ДНК, кодирующего эту последовательность аминокислот;
б) количество (в %) различных видов нуклеотидов в этом участке гена (в двух цепях);
в) длину этого участка гена.

а) По таблице кодонов (Приложение 6) находим триплеты иРНК, кодирующие каждую из указанных аминокислот.
Белок: Асп–Ала–Мет–Вал
иРНК: ГАЦ–ГЦА–АУГ–ГУУ
Если аминокислоте соответствуют несколькими кодонов, то можно выбрать любой из них.
Определяем строение той цепочки ДНК, которая кодировала строение иРНК. Для этого под каждым кодоном молекулы иРНК записываем комплементарный ему кодон молекулы ДНК.
1-я цепь ДНК: ЦТГ–ЦГТ–ТАЦ–ЦАА.

б) Чтобы определить количество (%) нуклеотидов в этом гене, необходимо, используя принцип комплементарности (А–Т, Г–Ц), достроить вторую цепь ДНК:
2-я цепь ДНК: ГАЦ–ГЦА–АТГ–ГТТ
Находим количество нуклеотидов (нтд): в двух цепях – 24 нтд, из них А = 6. Составляем пропорцию:
24 нтд – 100%
6 нтд – х%
х = (6×100) : 24 = 25%

По правилу Чаргаффа количество аденина в молекуле ДНК равно количеству тимина, а количество гуанина равно количеству цитозина. Поэтому:

Т = А = 25%
Т + А = 50%, следовательно
Ц + Г = 100% – 50% = 50%.
Ц = Г = 25%.

в) Молекула ДНК всегда двухцепочечная, ее длина равна длине одной цепи. Длина каждого нуклеотида составляет 0,34 нм, следовательно:
12 нтд x 0,34 = 4,08 нм.

Задача 3. Молекулярная масса белка Х равна 50 тыс. дальтонов (50 кДа). Определите длину соответствующего гена.

[1]

Примечание. Среднюю молекулярную массу одной аминокислоты можно принять равной 100 Да, а одного нуклеотида – 345 Да.

Белок Х состоит из 50 000 : 100 = 500 аминокислот.
Одна из цепей гена, кодирующего белок X, должна состоять из 500 триплетов, или 500 x 3 = 1500 нтд.
Длина такой цепи ДНК равна 1500 x 0,34 нм = 510 нм. Такова же длина гена (двухцепочечного участка ДНК).

Решение задач по общей генетике

Основные понятия и символы

Ген – участок молекулы ДНК в хромосоме, содержащий информацию о первичной структуре одного белка; гены всегда парные.

Генотип – совокупность всех генов организма.

Фенотип – совокупность всех внешних признаков организма.

Гибрид – организм, сформировавшийся в результате скрещивания особей, различающихся по ряду признаков.

Читайте так же:  Л карнитин разовая доза

Альтернативные признаки – контрастные признаки (белый – черный, желтый – зеленый).

Локус – местоположение гена в хромосоме.

Аллельные гены – два гена, занимающие одинаковые локусы в гомологичных хромосомах и определяющие альтернативные признаки.

Неаллельные гены – гены, занимающие разные локусы в хромосомах.

Признаки, наследуемые по Менделю, – наиболее часто встречающиеся в решении задач (Приложение 7).

Аллельные гены могут находиться в двух состояниях: доминантном, обозначаемом прописной буквой латинского алфавита (А, В, С и т.д.), или рецессивном, обозначаемом строчной буквой (а, b, с и т.д.).

Организмы, имеющие одинаковые аллели одного гена, например доминантные (АА) или рецессивные (аа), называются гомозиготными. Они дают один сорт гамет (А) или (а).

Организмы, имеющие разные аллели одного гена (Аа), называются гетерозиготными. Они дают два сорта гамет (А и а).

х – скрещивание организмов;
Р – родители;
F – дети; индекс означает номер поколения: F1, F2, Fn и т.д.;
Г – гаметы родителей или половые клетки;

– «щит и копье Марса», мужской пол;
– «зеркало Венеры», женский пол.

Этапы решения задач

1. Запись генотипов и фенотипов родителей.
2. Запись возможных типов гамет у каждого родителя.
3. Запись возможных типов зигот.
4. Подсчет соотношения генотипов и фенотипов потомства.

1. Графический способ:

2. Алгебраический способ:

3. Решетка Пеннета:

Моногибридное скрещивание

Решение задач на моногибридное скрещивание включает анализ наследования признаков, определяемых лишь одной парой аллельных генов. Мендель определил, что при скрещивании гомозиготных особей, отличающихся одной парой признаков, все потомство фенотипически единообразно (I закон Менделя).

При полном доминировании гибриды I поколения обладают признаками только одного из родителей, поскольку в этом случае проявление гена А в аллельной паре не зависит от присутствия другого гена а (аллель а не проявляется, поэтому ее называют рецессивной), и гетерозиготы (Аа) фенотипически не отличаются от гомозигот (АА).

При скрещивании моногибридов во втором поколении происходит расщепление признаков на исходные родительские в отношении 3 : 1 по фенотипу и 1 : 2 : 1 по генотипу (II закон Менделя): 3/4 потомков имеют признаки, обусловленные доминантным геном, 1/4 – признак рецессивного гена.

Задача 1. Определите генотипы и фенотипы потомства кареглазых гетерозиготных родителей.

А – карие глаза
а – голубые глаза
Определить: F1

Гетерозиготные кареглазые родители Аа

Происходит расщепление признаков, согласно II закону Менделя:

по фенотипу 3 : 1
по генотипу 1 : 2 : 1

Задача 2. Найти соотношение гладких и морщинистых семян у гороха в первом поколении, полученном при опылении растений с морщинистыми семенами пыльцой гомозиготных растений с гладкими семенами.

А – гладкие семена
a – морщинистые семена
Определить: F1

Согласно I закону Менделя все семена гладкие.
Возможна и другая запись.

Гомозиготы по данной паре признаков образуют один сорт гамет:

При неполном доминировании функционируют оба гена, поэтому фенотип гибридов отличается от гомозигот по обоим аллелям (АА и аа) промежуточным проявлением признака, и во втором поколении происходит расщепление на три класса в отношении 1:2:1 как по генотипу, так и по фенотипу.

Задача 3. Растения красноплодного крыжовника при скрещивании между собой дают потомство с красными ягодами, а растения белоплодного крыжовника – белыми. В результате скрещивания обоих сортов друг с другом получаются розовые плоды.

1. Какое потомство получится при скрещивании между собой гетерозиготных растений крыжовника с розовыми плодамиx

2. Какое потомство получится, если опылить красноплодный крыжовник пыльцой гибридного крыжовника с розовыми плодамиx

А – красная окраска плодов
а – белая окраска плодов
F1 – x

[2]

Ответ: при скрещивании гибридных растений с розовыми плодами в потомстве происходит расщепление в соотношении по фенотипу и генотипу 1:2:1.

При скрещивании красноплодного крыжовника с розовоплодным в потомстве получится расщепление по фенотипу и генотипу в соотношении 1:1.

В генетике часто используют анализирующее скрещивание. Это скрещивание гибрида, генотип которого неясен, с гомозиготной особью по рецессивным генам аллеля. Расщепление в потомстве по признаку происходит в соотношении 1:1.

Дигибридное скрещивание

Дигибридное скрещивание – это скрещивание, при котором организмы отличаются двумя парами альтернативных признаков. Гибриды, полученные от такого скрещивания, называются дигетерозиготами. При скрещивании двух гомозиготных особей, отличающихся друг от друга по двум и более парам признаков, гены и соответствующие им признаки наследуются независимо друг от друга и комбинируются во всех возможных сочетаниях. При дигибридном скрещивании двух дигетерозигот (особей F1) между собой во втором поколении гибридов (F2) будет наблюдаться расщепление признаков по фенотипу в соотношении 9:3:3:1 (III закон Менделя). Это соотношение фенотипов – результат наложения двух моногибридных расщеплений:

, где «n» – число пар признаков.
Число возможных вариантов гамет равно 2 n , где n – число гетерозиготных пар генов в геноме, а 2 – возможное число гамет у моногибридов.

Образование четырех сортов гамет возможно, т.к. в мейозе (профаза I) происходит конъюгация и кроссинговер хромосом.

Задача 4. Какими признаками будут обладать гибридные абрикосы, полученные в результате опыления дигомозиготных красноплодных растений нормального роста, пыльцой желтоплодных карликовых растенийx Какой результат даст дальнейшее скрещивание таких гибридовx

А – красная окраска плодов
а – желтая окраска плодов
В – нормальный рост
b – карликовый рост

Ответ: при скрещивании гибридов в F2 произойдет расщепление в соотношении:

Видео удалено.
Видео (кликните для воспроизведения).

9/16 – красноплодные, нормальный рост;
3/16 – красноплодные, карликовый рост;
3/16 – желтоплодные, нормальный рост;
1/16 – желтоплодные, карликовый рост.

Источники


  1. Моэс-Оскрагелло, К. Природная пища человека. Питание и здоровье. Выпуск 5 / К. Моэс-Оскрагелло. — М.: Осознание, Самотека, 2015. — 128 c.

  2. Батмангхелидж Вода для здоровья / Батмангхелидж, Фирейдон. — М.: Попурри, 2008. — 544 c.

  3. Блондин, Кале-Жермен Анатомия упражнений для пресса. Основы персональной тренировки. 16 безопасных упражнений для мышц живота. Пошаговые иллюстрированные инструкции / Кале-Жермен Блондин. — М.: Эксмо, 2011. — 716 c.
Таблица аминокислот и триплетов
Оценка 5 проголосовавших: 1

ОСТАВЬТЕ ОТВЕТ

Please enter your comment!
Please enter your name here